Incidental Mutation 'R8694:Nos2'
ID 668577
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8694 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78945689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 531 (V531D)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: V531D

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: V531D

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: V418D

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,510,769 D1735G probably benign Het
Adar T C 3: 89,735,643 L277P probably damaging Het
Adgrb3 C A 1: 25,826,391 D124Y probably damaging Het
Afdn T C 17: 13,888,379 V1403A probably benign Het
Afg3l1 T C 8: 123,501,234 V586A probably damaging Het
Aloxe3 A G 11: 69,142,851 D597G probably damaging Het
Asb15 T C 6: 24,570,667 V548A probably benign Het
Atp6v1a C T 16: 44,101,628 R388Q probably damaging Het
C130074G19Rik G A 1: 184,882,987 T2M probably damaging Het
Ccdc187 T C 2: 26,275,493 T884A probably benign Het
Cdk5rap1 G A 2: 154,353,228 R356* probably null Het
Cebpz A T 17: 78,926,905 H725Q probably damaging Het
Celsr2 T C 3: 108,406,860 D1283G probably damaging Het
Cldn11 G T 3: 31,163,090 V136F probably damaging Het
Cpxm2 T C 7: 132,080,054 N249D probably benign Het
Ctsz T C 2: 174,438,279 N67D probably benign Het
Drd3 A C 16: 43,822,712 H405P probably damaging Het
F2rl2 T C 13: 95,700,831 V128A probably benign Het
Fh1 C T 1: 175,620,560 P43S probably benign Het
Fndc7 C T 3: 108,872,306 W307* probably null Het
Gm996 A G 2: 25,579,819 S27P possibly damaging Het
Gmip G T 8: 69,817,835 V732L probably benign Het
Heatr4 A G 12: 83,980,264 F73S probably damaging Het
Iqcf4 T C 9: 106,570,912 probably benign Het
Itln1 T A 1: 171,531,711 Q67L probably damaging Het
Jak1 A G 4: 101,156,507 V1008A probably damaging Het
Kcnh1 A T 1: 192,238,723 probably benign Het
Kcnu1 T G 8: 25,852,073 probably benign Het
Kif1b A G 4: 149,220,567 S967P probably damaging Het
Klra17 A G 6: 129,874,817 S31P probably benign Het
Kmt2d C T 15: 98,844,734 E4182K unknown Het
Lama5 T C 2: 180,180,884 D2825G probably damaging Het
Lmtk2 T C 5: 144,171,748 V336A probably damaging Het
Mad1l1 A G 5: 140,088,683 I584T probably benign Het
Magea1 T A X: 155,088,791 N313I possibly damaging Het
Mapt T C 11: 104,298,614 S153P probably benign Het
Myo1e T C 9: 70,383,890 Y988H probably benign Het
Ndufc2 A T 7: 97,400,196 N3I probably benign Het
Npbwr1 T A 1: 5,916,398 Y299F probably damaging Het
Olfr1100 G A 2: 86,978,247 P183L probably damaging Het
Olfr1238 A G 2: 89,407,034 L15P probably damaging Het
Olfr1242 A G 2: 89,493,827 Y162H possibly damaging Het
Olfr659 G T 7: 104,671,089 C129F probably damaging Het
Pp2d1 T C 17: 53,508,163 Y511C probably benign Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Setbp1 T C 18: 78,858,301 K717R probably damaging Het
Slc25a11 T C 11: 70,644,804 M303V probably benign Het
Spesp1 A T 9: 62,272,960 M222K probably benign Het
Tmem132d A G 5: 127,792,431 M613T probably benign Het
Ugt2a2 A G 5: 87,464,170 F294L probably damaging Het
Usp34 A G 11: 23,484,161 T3246A Het
Zfp750 T A 11: 121,513,630 I140F possibly damaging Het
Zscan4e A T 7: 11,307,647 H127Q possibly damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAGATTTGCCAAAGAGACTG -3'
(R):5'- GACAACCTGTGTGACAACCG -3'

Sequencing Primer
(F):5'- TTTGCCAAAGAGACTGAGTCAG -3'
(R):5'- CTGTGTGACAACCGTTGAAC -3'
Posted On 2021-04-30