Incidental Mutation 'R8695:Usp44'
ID 668632
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
MMRRC Submission 068549-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8695 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 93682365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 272 (T272P)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000095333
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216224
AA Change: T272P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 86,138,870 (GRCm39) I73T probably benign Het
4930556J24Rik A G 11: 3,926,192 (GRCm39) probably benign Het
Ace A G 11: 105,875,971 (GRCm39) T1010A probably benign Het
Adam20 A T 8: 41,248,865 (GRCm39) Y325F probably benign Het
Aff4 A C 11: 53,259,509 (GRCm39) N7H probably damaging Het
Apob A T 12: 8,057,830 (GRCm39) D2104V probably damaging Het
Asap3 T C 4: 135,965,722 (GRCm39) S411P probably benign Het
Atxn1l C T 8: 110,458,462 (GRCm39) G600D probably damaging Het
Brd3 A T 2: 27,352,558 (GRCm39) M124K probably benign Het
Bsx A G 9: 40,785,484 (GRCm39) N4S probably damaging Het
Ccdc125 T C 13: 100,814,552 (GRCm39) I44T probably benign Het
Ccdc141 G A 2: 76,879,963 (GRCm39) T620I probably benign Het
Ccdc178 T A 18: 22,157,809 (GRCm39) I550F probably benign Het
Ccdc77 G T 6: 120,318,962 (GRCm39) T163N probably damaging Het
Cd55 A T 1: 130,380,273 (GRCm39) I235K probably benign Het
Cdc123 A T 2: 5,826,174 (GRCm39) M118K possibly damaging Het
Cep192 A T 18: 67,951,958 (GRCm39) K378* probably null Het
Chd7 C T 4: 8,850,812 (GRCm39) R1733C probably damaging Het
Crybg2 A T 4: 133,792,766 (GRCm39) S134C possibly damaging Het
Cyp2d26 A G 15: 82,676,907 (GRCm39) probably benign Het
D430041D05Rik A G 2: 104,085,299 (GRCm39) probably null Het
Dyrk2 A T 10: 118,696,922 (GRCm39) V112E probably benign Het
Eppk1 A G 15: 75,994,598 (GRCm39) L761P probably benign Het
Evpl T C 11: 116,114,489 (GRCm39) K1067R probably benign Het
Fancm C A 12: 65,171,947 (GRCm39) D1862E probably damaging Het
Fhl2 A G 1: 43,167,571 (GRCm39) V174A probably damaging Het
Gemin4 A T 11: 76,102,656 (GRCm39) C702S probably damaging Het
Ggnbp2 T A 11: 84,760,767 (GRCm39) D10V possibly damaging Het
Glul T C 1: 153,778,769 (GRCm39) V26A probably benign Het
Gml2 A G 15: 74,696,089 (GRCm39) N161S probably benign Het
Gnao1 C A 8: 94,682,795 (GRCm39) T327K probably damaging Het
Gpr179 A G 11: 97,227,124 (GRCm39) V1677A possibly damaging Het
Greb1l A T 18: 10,544,450 (GRCm39) H1348L probably benign Het
Grm8 T C 6: 28,126,030 (GRCm39) H32R probably benign Het
Hk2 T A 6: 82,716,627 (GRCm39) M302L probably benign Het
Hnrnpm C A 17: 33,877,884 (GRCm39) M333I probably benign Het
Hsd3b1 A G 3: 98,760,223 (GRCm39) I256T probably damaging Het
Irx5 G A 8: 93,087,327 (GRCm39) G420R probably damaging Het
Krt87 A G 15: 101,331,901 (GRCm39) V279A probably benign Het
Lamb2 G A 9: 108,363,365 (GRCm39) S848N probably benign Het
Lypd10 A T 7: 24,413,203 (GRCm39) H174L probably benign Het
Mc1r A T 8: 124,135,116 (GRCm39) T290S probably benign Het
Or10d4 A T 9: 39,580,376 (GRCm39) T8S probably benign Het
Or52n2c A T 7: 104,574,146 (GRCm39) V275D probably benign Het
Or52z1 A T 7: 103,436,729 (GRCm39) C252S possibly damaging Het
Or6c202 T A 10: 128,996,233 (GRCm39) T207S probably damaging Het
Pex6 T C 17: 47,022,975 (GRCm39) S184P probably damaging Het
Pglyrp3 A T 3: 91,933,762 (GRCm39) S136C probably null Het
Pik3r1 A G 13: 101,894,062 (GRCm39) S36P probably benign Het
Pomt2 G T 12: 87,156,790 (GRCm39) T782K probably benign Het
Ppfibp2 A G 7: 107,285,063 (GRCm39) probably benign Het
Prdm9 T C 17: 15,765,019 (GRCm39) H587R probably damaging Het
Prp2 A G 6: 132,576,932 (GRCm39) Q73R unknown Het
Psmb4 T C 3: 94,793,435 (GRCm39) N149D probably benign Het
Ptprj A T 2: 90,301,481 (GRCm39) I217N possibly damaging Het
Rasal3 A G 17: 32,611,736 (GRCm39) F797S possibly damaging Het
Rsrp1 T A 4: 134,652,610 (GRCm39) M188K probably damaging Het
Senp8 A G 9: 59,644,499 (GRCm39) I219T probably damaging Het
Serpinb10 A T 1: 107,468,630 (GRCm39) N91I probably damaging Het
Skint4 C T 4: 111,975,264 (GRCm39) R75C probably damaging Het
Slc25a48 C A 13: 56,612,825 (GRCm39) A241E probably damaging Het
Slc39a6 C A 18: 24,736,811 (GRCm39) probably benign Het
Smarcc1 G A 9: 110,002,972 (GRCm39) R354H probably damaging Het
Spata21 G C 4: 140,838,755 (GRCm39) probably null Het
Sptbn2 A G 19: 4,796,724 (GRCm39) E1774G possibly damaging Het
Tep1 A T 14: 51,082,894 (GRCm39) F1038Y possibly damaging Het
Thbs2 T A 17: 14,899,963 (GRCm39) D638V probably benign Het
Tmem161a G T 8: 70,627,047 (GRCm39) C33F probably damaging Het
Trim47 T C 11: 116,000,926 (GRCm39) S41G probably benign Het
Trim56 T A 5: 137,143,429 (GRCm39) H29L probably benign Het
Ugt2b35 T A 5: 87,156,064 (GRCm39) H385Q probably damaging Het
Ugt2b37 T A 5: 87,390,243 (GRCm39) H401L probably benign Het
Usp46 C T 5: 74,189,897 (GRCm39) E156K probably benign Het
Vmn1r232 T C 17: 21,134,109 (GRCm39) K164E probably benign Het
Zan T A 5: 137,385,217 (GRCm39) N5072I unknown Het
Zfp318 T C 17: 46,723,576 (GRCm39) S1860P probably benign Het
Zfp616 C T 11: 73,975,710 (GRCm39) R660W probably benign Het
Zfp870 C T 17: 33,102,679 (GRCm39) V217I possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93,686,049 (GRCm39) missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8014:Usp44 UTSW 10 93,688,571 (GRCm39) critical splice acceptor site probably null
R8919:Usp44 UTSW 10 93,693,775 (GRCm39) missense probably benign 0.00
R8950:Usp44 UTSW 10 93,682,129 (GRCm39) missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TACGCTTACAAGGCTCCTCG -3'
(R):5'- TGGAGCATACGAAGCCTTTCTC -3'

Sequencing Primer
(F):5'- CACAATCGAAATCGTGCC -3'
(R):5'- GAGCATACGAAGCCTTTCTCTTTCTC -3'
Posted On 2021-04-30