Incidental Mutation 'R8695:Aff4'
ID 668636
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8695 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53368682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 7 (N7H)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945] [ENSMUST00000153821]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: N7H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: N7H

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153821
AA Change: N7H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120613
Gene: ENSMUSG00000049470
AA Change: N7H

DomainStartEndE-ValueType
Pfam:AF-4 2 122 4.1e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 85,412,241 I73T probably benign Het
4930556J24Rik A G 11: 3,976,192 probably benign Het
Ace A G 11: 105,985,145 T1010A probably benign Het
Adam20 A T 8: 40,795,828 Y325F probably benign Het
Apob A T 12: 8,007,830 D2104V probably damaging Het
Asap3 T C 4: 136,238,411 S411P probably benign Het
Atxn1l C T 8: 109,731,830 G600D probably damaging Het
BC049730 A T 7: 24,713,778 H174L probably benign Het
Brd3 A T 2: 27,462,546 M124K probably benign Het
Bsx A G 9: 40,874,188 N4S probably damaging Het
Ccdc125 T C 13: 100,678,044 I44T probably benign Het
Ccdc141 G A 2: 77,049,619 T620I probably benign Het
Ccdc178 T A 18: 22,024,752 I550F probably benign Het
Ccdc77 G T 6: 120,342,001 T163N probably damaging Het
Cd55 A T 1: 130,452,536 I235K probably benign Het
Cdc123 A T 2: 5,821,363 M118K possibly damaging Het
Cep192 A T 18: 67,818,887 K378* probably null Het
Chd7 C T 4: 8,850,812 R1733C probably damaging Het
Crybg2 A T 4: 134,065,455 S134C possibly damaging Het
Cyp2d26 A G 15: 82,792,706 probably benign Het
D430041D05Rik A G 2: 104,254,954 probably null Het
Dyrk2 A T 10: 118,861,017 V112E probably benign Het
Eppk1 A G 15: 76,110,398 L761P probably benign Het
Evpl T C 11: 116,223,663 K1067R probably benign Het
Fancm C A 12: 65,125,173 D1862E probably damaging Het
Fhl2 A G 1: 43,128,411 V174A probably damaging Het
Gemin4 A T 11: 76,211,830 C702S probably damaging Het
Ggnbp2 T A 11: 84,869,941 D10V possibly damaging Het
Glul T C 1: 153,903,023 V26A probably benign Het
Gml2 A G 15: 74,824,240 N161S probably benign Het
Gnao1 C A 8: 93,956,167 T327K probably damaging Het
Gpr179 A G 11: 97,336,298 V1677A possibly damaging Het
Greb1l A T 18: 10,544,450 H1348L probably benign Het
Grm8 T C 6: 28,126,031 H32R probably benign Het
Hk2 T A 6: 82,739,646 M302L probably benign Het
Hnrnpm C A 17: 33,658,910 M333I probably benign Het
Hsd3b1 A G 3: 98,852,907 I256T probably damaging Het
Irx5 G A 8: 92,360,699 G420R probably damaging Het
Krt87 A G 15: 101,434,020 V279A probably benign Het
Lamb2 G A 9: 108,486,166 S848N probably benign Het
Mc1r A T 8: 123,408,377 T290S probably benign Het
Olfr668 A T 7: 104,924,939 V275D probably benign Het
Olfr67 A T 7: 103,787,522 C252S possibly damaging Het
Olfr771 T A 10: 129,160,364 T207S probably damaging Het
Olfr963 A T 9: 39,669,080 T8S probably benign Het
Pex6 T C 17: 46,712,049 S184P probably damaging Het
Pglyrp3 A T 3: 92,026,455 S136C probably null Het
Pik3r1 A G 13: 101,757,554 S36P probably benign Het
Pomt2 G T 12: 87,110,016 T782K probably benign Het
Ppfibp2 A G 7: 107,685,856 probably benign Het
Prdm9 T C 17: 15,544,757 H587R probably damaging Het
Prp2 A G 6: 132,599,969 Q73R unknown Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rasal3 A G 17: 32,392,762 F797S possibly damaging Het
Rsrp1 T A 4: 134,925,299 M188K probably damaging Het
Senp8 A G 9: 59,737,216 I219T probably damaging Het
Serpinb10 A T 1: 107,540,900 N91I probably damaging Het
Skint4 C T 4: 112,118,067 R75C probably damaging Het
Slc25a48 C A 13: 56,465,012 A241E probably damaging Het
Slc39a6 C A 18: 24,603,754 probably benign Het
Smarcc1 G A 9: 110,173,904 R354H probably damaging Het
Spata21 G C 4: 141,111,444 probably null Het
Sptbn2 A G 19: 4,746,696 E1774G possibly damaging Het
Tep1 A T 14: 50,845,437 F1038Y possibly damaging Het
Thbs2 T A 17: 14,679,701 D638V probably benign Het
Tmem161a G T 8: 70,174,397 C33F probably damaging Het
Trim47 T C 11: 116,110,100 S41G probably benign Het
Trim56 T A 5: 137,114,575 H29L probably benign Het
Ugt2b35 T A 5: 87,008,205 H385Q probably damaging Het
Ugt2b37 T A 5: 87,242,384 H401L probably benign Het
Usp44 A C 10: 93,846,503 T272P probably damaging Het
Usp46 C T 5: 74,029,236 E156K probably benign Het
Vmn1r232 T C 17: 20,913,847 K164E probably benign Het
Zan T A 5: 137,386,955 N5072I unknown Het
Zfp318 T C 17: 46,412,650 S1860P probably benign Het
Zfp616 C T 11: 74,084,884 R660W probably benign Het
Zfp870 C T 17: 32,883,705 V217I possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCCAGAATCCCATTTCAGC -3'
(R):5'- ATGCCTGGAAGAGTCACAC -3'

Sequencing Primer
(F):5'- TTCAGCACTAACTAACACCTGTTAAC -3'
(R):5'- GAGTCACACTCACACCAAAAC -3'
Posted On 2021-04-30