Incidental Mutation 'R8695:Pomt2'
ID668646
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8695 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87110016 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 782 (T782K)
Ref Sequence ENSEMBL: ENSMUSP00000035260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably benign
Transcript: ENSMUST00000037788
AA Change: T782K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126
AA Change: T782K

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222634
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 85,412,241 I73T probably benign Het
4930556J24Rik A G 11: 3,976,192 probably benign Het
Ace A G 11: 105,985,145 T1010A probably benign Het
Adam20 A T 8: 40,795,828 Y325F probably benign Het
Aff4 A C 11: 53,368,682 N7H probably damaging Het
Apob A T 12: 8,007,830 D2104V probably damaging Het
Asap3 T C 4: 136,238,411 S411P probably benign Het
Atxn1l C T 8: 109,731,830 G600D probably damaging Het
BC049730 A T 7: 24,713,778 H174L probably benign Het
Brd3 A T 2: 27,462,546 M124K probably benign Het
Bsx A G 9: 40,874,188 N4S probably damaging Het
Ccdc125 T C 13: 100,678,044 I44T probably benign Het
Ccdc141 G A 2: 77,049,619 T620I probably benign Het
Ccdc178 T A 18: 22,024,752 I550F probably benign Het
Ccdc77 G T 6: 120,342,001 T163N probably damaging Het
Cd55 A T 1: 130,452,536 I235K probably benign Het
Cdc123 A T 2: 5,821,363 M118K possibly damaging Het
Cep192 A T 18: 67,818,887 K378* probably null Het
Chd7 C T 4: 8,850,812 R1733C probably damaging Het
Crybg2 A T 4: 134,065,455 S134C possibly damaging Het
Cyp2d26 A G 15: 82,792,706 probably benign Het
D430041D05Rik A G 2: 104,254,954 probably null Het
Dyrk2 A T 10: 118,861,017 V112E probably benign Het
Eppk1 A G 15: 76,110,398 L761P probably benign Het
Evpl T C 11: 116,223,663 K1067R probably benign Het
Fancm C A 12: 65,125,173 D1862E probably damaging Het
Fhl2 A G 1: 43,128,411 V174A probably damaging Het
Gemin4 A T 11: 76,211,830 C702S probably damaging Het
Ggnbp2 T A 11: 84,869,941 D10V possibly damaging Het
Glul T C 1: 153,903,023 V26A probably benign Het
Gml2 A G 15: 74,824,240 N161S probably benign Het
Gnao1 C A 8: 93,956,167 T327K probably damaging Het
Gpr179 A G 11: 97,336,298 V1677A possibly damaging Het
Greb1l A T 18: 10,544,450 H1348L probably benign Het
Grm8 T C 6: 28,126,031 H32R probably benign Het
Hk2 T A 6: 82,739,646 M302L probably benign Het
Hnrnpm C A 17: 33,658,910 M333I probably benign Het
Hsd3b1 A G 3: 98,852,907 I256T probably damaging Het
Irx5 G A 8: 92,360,699 G420R probably damaging Het
Krt87 A G 15: 101,434,020 V279A probably benign Het
Lamb2 G A 9: 108,486,166 S848N probably benign Het
Mc1r A T 8: 123,408,377 T290S probably benign Het
Olfr668 A T 7: 104,924,939 V275D probably benign Het
Olfr67 A T 7: 103,787,522 C252S possibly damaging Het
Olfr771 T A 10: 129,160,364 T207S probably damaging Het
Olfr963 A T 9: 39,669,080 T8S probably benign Het
Pex6 T C 17: 46,712,049 S184P probably damaging Het
Pglyrp3 A T 3: 92,026,455 S136C probably null Het
Pik3r1 A G 13: 101,757,554 S36P probably benign Het
Ppfibp2 A G 7: 107,685,856 probably benign Het
Prdm9 T C 17: 15,544,757 H587R probably damaging Het
Prp2 A G 6: 132,599,969 Q73R unknown Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rasal3 A G 17: 32,392,762 F797S possibly damaging Het
Rsrp1 T A 4: 134,925,299 M188K probably damaging Het
Senp8 A G 9: 59,737,216 I219T probably damaging Het
Serpinb10 A T 1: 107,540,900 N91I probably damaging Het
Skint4 C T 4: 112,118,067 R75C probably damaging Het
Slc25a48 C A 13: 56,465,012 A241E probably damaging Het
Slc39a6 C A 18: 24,603,754 probably benign Het
Smarcc1 G A 9: 110,173,904 R354H probably damaging Het
Spata21 G C 4: 141,111,444 probably null Het
Sptbn2 A G 19: 4,746,696 E1774G possibly damaging Het
Tep1 A T 14: 50,845,437 F1038Y possibly damaging Het
Thbs2 T A 17: 14,679,701 D638V probably benign Het
Tmem161a G T 8: 70,174,397 C33F probably damaging Het
Trim47 T C 11: 116,110,100 S41G probably benign Het
Trim56 T A 5: 137,114,575 H29L probably benign Het
Ugt2b35 T A 5: 87,008,205 H385Q probably damaging Het
Ugt2b37 T A 5: 87,242,384 H401L probably benign Het
Usp44 A C 10: 93,846,503 T272P probably damaging Het
Usp46 C T 5: 74,029,236 E156K probably benign Het
Vmn1r232 T C 17: 20,913,847 K164E probably benign Het
Zan T A 5: 137,386,955 N5072I unknown Het
Zfp318 T C 17: 46,412,650 S1860P probably benign Het
Zfp616 C T 11: 74,084,884 R660W probably benign Het
Zfp870 C T 17: 32,883,705 V217I possibly damaging Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
PIT4366001:Pomt2 UTSW 12 87116529 critical splice donor site probably null
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4482:Pomt2 UTSW 12 87131830 missense probably benign 0.41
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R5790:Pomt2 UTSW 12 87127378 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6370:Pomt2 UTSW 12 87109199 missense probably damaging 1.00
R6631:Pomt2 UTSW 12 87139643 critical splice donor site probably null
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
R7690:Pomt2 UTSW 12 87130367 missense probably damaging 1.00
R7864:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R8060:Pomt2 UTSW 12 87129006 missense probably damaging 1.00
R8851:Pomt2 UTSW 12 87138064 missense probably damaging 0.99
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Z1177:Pomt2 UTSW 12 87111442 missense possibly damaging 0.74
Z1177:Pomt2 UTSW 12 87139681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGGCCCTTGCTATTTC -3'
(R):5'- AAGTCACCCTGAGAAACTGGTC -3'

Sequencing Primer
(F):5'- CTACCGGACTATACATTAGGGTC -3'
(R):5'- CCTGAGAAACTGGTCTGGGG -3'
Posted On2021-04-30