Incidental Mutation 'R8695:Greb1l'
ID668663
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8695 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10544450 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1348 (H1348L)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: H1348L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H1348L

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (78/78)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 85,412,241 I73T probably benign Het
4930556J24Rik A G 11: 3,976,192 probably benign Het
Ace A G 11: 105,985,145 T1010A probably benign Het
Adam20 A T 8: 40,795,828 Y325F probably benign Het
Aff4 A C 11: 53,368,682 N7H probably damaging Het
Apob A T 12: 8,007,830 D2104V probably damaging Het
Asap3 T C 4: 136,238,411 S411P probably benign Het
Atxn1l C T 8: 109,731,830 G600D probably damaging Het
BC049730 A T 7: 24,713,778 H174L probably benign Het
Brd3 A T 2: 27,462,546 M124K probably benign Het
Bsx A G 9: 40,874,188 N4S probably damaging Het
Ccdc125 T C 13: 100,678,044 I44T probably benign Het
Ccdc141 G A 2: 77,049,619 T620I probably benign Het
Ccdc178 T A 18: 22,024,752 I550F probably benign Het
Ccdc77 G T 6: 120,342,001 T163N probably damaging Het
Cd55 A T 1: 130,452,536 I235K probably benign Het
Cdc123 A T 2: 5,821,363 M118K possibly damaging Het
Cep192 A T 18: 67,818,887 K378* probably null Het
Chd7 C T 4: 8,850,812 R1733C probably damaging Het
Crybg2 A T 4: 134,065,455 S134C possibly damaging Het
Cyp2d26 A G 15: 82,792,706 probably benign Het
D430041D05Rik A G 2: 104,254,954 probably null Het
Dyrk2 A T 10: 118,861,017 V112E probably benign Het
Eppk1 A G 15: 76,110,398 L761P probably benign Het
Evpl T C 11: 116,223,663 K1067R probably benign Het
Fancm C A 12: 65,125,173 D1862E probably damaging Het
Fhl2 A G 1: 43,128,411 V174A probably damaging Het
Gemin4 A T 11: 76,211,830 C702S probably damaging Het
Ggnbp2 T A 11: 84,869,941 D10V possibly damaging Het
Glul T C 1: 153,903,023 V26A probably benign Het
Gml2 A G 15: 74,824,240 N161S probably benign Het
Gnao1 C A 8: 93,956,167 T327K probably damaging Het
Gpr179 A G 11: 97,336,298 V1677A possibly damaging Het
Grm8 T C 6: 28,126,031 H32R probably benign Het
Hk2 T A 6: 82,739,646 M302L probably benign Het
Hnrnpm C A 17: 33,658,910 M333I probably benign Het
Hsd3b1 A G 3: 98,852,907 I256T probably damaging Het
Irx5 G A 8: 92,360,699 G420R probably damaging Het
Krt87 A G 15: 101,434,020 V279A probably benign Het
Lamb2 G A 9: 108,486,166 S848N probably benign Het
Mc1r A T 8: 123,408,377 T290S probably benign Het
Olfr668 A T 7: 104,924,939 V275D probably benign Het
Olfr67 A T 7: 103,787,522 C252S possibly damaging Het
Olfr771 T A 10: 129,160,364 T207S probably damaging Het
Olfr963 A T 9: 39,669,080 T8S probably benign Het
Pex6 T C 17: 46,712,049 S184P probably damaging Het
Pglyrp3 A T 3: 92,026,455 S136C probably null Het
Pik3r1 A G 13: 101,757,554 S36P probably benign Het
Pomt2 G T 12: 87,110,016 T782K probably benign Het
Ppfibp2 A G 7: 107,685,856 probably benign Het
Prdm9 T C 17: 15,544,757 H587R probably damaging Het
Prp2 A G 6: 132,599,969 Q73R unknown Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rasal3 A G 17: 32,392,762 F797S possibly damaging Het
Rsrp1 T A 4: 134,925,299 M188K probably damaging Het
Senp8 A G 9: 59,737,216 I219T probably damaging Het
Serpinb10 A T 1: 107,540,900 N91I probably damaging Het
Skint4 C T 4: 112,118,067 R75C probably damaging Het
Slc25a48 C A 13: 56,465,012 A241E probably damaging Het
Slc39a6 C A 18: 24,603,754 probably benign Het
Smarcc1 G A 9: 110,173,904 R354H probably damaging Het
Spata21 G C 4: 141,111,444 probably null Het
Sptbn2 A G 19: 4,746,696 E1774G possibly damaging Het
Tep1 A T 14: 50,845,437 F1038Y possibly damaging Het
Thbs2 T A 17: 14,679,701 D638V probably benign Het
Tmem161a G T 8: 70,174,397 C33F probably damaging Het
Trim47 T C 11: 116,110,100 S41G probably benign Het
Trim56 T A 5: 137,114,575 H29L probably benign Het
Ugt2b35 T A 5: 87,008,205 H385Q probably damaging Het
Ugt2b37 T A 5: 87,242,384 H401L probably benign Het
Usp44 A C 10: 93,846,503 T272P probably damaging Het
Usp46 C T 5: 74,029,236 E156K probably benign Het
Vmn1r232 T C 17: 20,913,847 K164E probably benign Het
Zan T A 5: 137,386,955 N5072I unknown Het
Zfp318 T C 17: 46,412,650 S1860P probably benign Het
Zfp616 C T 11: 74,084,884 R660W probably benign Het
Zfp870 C T 17: 32,883,705 V217I possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGATAAGAGAGCTCCTTG -3'
(R):5'- CTCAAAGGAGTGGACTGTCC -3'

Sequencing Primer
(F):5'- GCTCAGCAATGTCTCCCTGG -3'
(R):5'- GAGTTCCCTTGACCTGCACAG -3'
Posted On2021-04-30