Incidental Mutation 'R8695:Greb1l'
ID 668663
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 068549-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8695 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10544450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1348 (H1348L)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: H1348L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H1348L

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (78/78)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 86,138,870 (GRCm39) I73T probably benign Het
4930556J24Rik A G 11: 3,926,192 (GRCm39) probably benign Het
Ace A G 11: 105,875,971 (GRCm39) T1010A probably benign Het
Adam20 A T 8: 41,248,865 (GRCm39) Y325F probably benign Het
Aff4 A C 11: 53,259,509 (GRCm39) N7H probably damaging Het
Apob A T 12: 8,057,830 (GRCm39) D2104V probably damaging Het
Asap3 T C 4: 135,965,722 (GRCm39) S411P probably benign Het
Atxn1l C T 8: 110,458,462 (GRCm39) G600D probably damaging Het
Brd3 A T 2: 27,352,558 (GRCm39) M124K probably benign Het
Bsx A G 9: 40,785,484 (GRCm39) N4S probably damaging Het
Ccdc125 T C 13: 100,814,552 (GRCm39) I44T probably benign Het
Ccdc141 G A 2: 76,879,963 (GRCm39) T620I probably benign Het
Ccdc178 T A 18: 22,157,809 (GRCm39) I550F probably benign Het
Ccdc77 G T 6: 120,318,962 (GRCm39) T163N probably damaging Het
Cd55 A T 1: 130,380,273 (GRCm39) I235K probably benign Het
Cdc123 A T 2: 5,826,174 (GRCm39) M118K possibly damaging Het
Cep192 A T 18: 67,951,958 (GRCm39) K378* probably null Het
Chd7 C T 4: 8,850,812 (GRCm39) R1733C probably damaging Het
Crybg2 A T 4: 133,792,766 (GRCm39) S134C possibly damaging Het
Cyp2d26 A G 15: 82,676,907 (GRCm39) probably benign Het
D430041D05Rik A G 2: 104,085,299 (GRCm39) probably null Het
Dyrk2 A T 10: 118,696,922 (GRCm39) V112E probably benign Het
Eppk1 A G 15: 75,994,598 (GRCm39) L761P probably benign Het
Evpl T C 11: 116,114,489 (GRCm39) K1067R probably benign Het
Fancm C A 12: 65,171,947 (GRCm39) D1862E probably damaging Het
Fhl2 A G 1: 43,167,571 (GRCm39) V174A probably damaging Het
Gemin4 A T 11: 76,102,656 (GRCm39) C702S probably damaging Het
Ggnbp2 T A 11: 84,760,767 (GRCm39) D10V possibly damaging Het
Glul T C 1: 153,778,769 (GRCm39) V26A probably benign Het
Gml2 A G 15: 74,696,089 (GRCm39) N161S probably benign Het
Gnao1 C A 8: 94,682,795 (GRCm39) T327K probably damaging Het
Gpr179 A G 11: 97,227,124 (GRCm39) V1677A possibly damaging Het
Grm8 T C 6: 28,126,030 (GRCm39) H32R probably benign Het
Hk2 T A 6: 82,716,627 (GRCm39) M302L probably benign Het
Hnrnpm C A 17: 33,877,884 (GRCm39) M333I probably benign Het
Hsd3b1 A G 3: 98,760,223 (GRCm39) I256T probably damaging Het
Irx5 G A 8: 93,087,327 (GRCm39) G420R probably damaging Het
Krt87 A G 15: 101,331,901 (GRCm39) V279A probably benign Het
Lamb2 G A 9: 108,363,365 (GRCm39) S848N probably benign Het
Lypd10 A T 7: 24,413,203 (GRCm39) H174L probably benign Het
Mc1r A T 8: 124,135,116 (GRCm39) T290S probably benign Het
Or10d4 A T 9: 39,580,376 (GRCm39) T8S probably benign Het
Or52n2c A T 7: 104,574,146 (GRCm39) V275D probably benign Het
Or52z1 A T 7: 103,436,729 (GRCm39) C252S possibly damaging Het
Or6c202 T A 10: 128,996,233 (GRCm39) T207S probably damaging Het
Pex6 T C 17: 47,022,975 (GRCm39) S184P probably damaging Het
Pglyrp3 A T 3: 91,933,762 (GRCm39) S136C probably null Het
Pik3r1 A G 13: 101,894,062 (GRCm39) S36P probably benign Het
Pomt2 G T 12: 87,156,790 (GRCm39) T782K probably benign Het
Ppfibp2 A G 7: 107,285,063 (GRCm39) probably benign Het
Prdm9 T C 17: 15,765,019 (GRCm39) H587R probably damaging Het
Prp2 A G 6: 132,576,932 (GRCm39) Q73R unknown Het
Psmb4 T C 3: 94,793,435 (GRCm39) N149D probably benign Het
Ptprj A T 2: 90,301,481 (GRCm39) I217N possibly damaging Het
Rasal3 A G 17: 32,611,736 (GRCm39) F797S possibly damaging Het
Rsrp1 T A 4: 134,652,610 (GRCm39) M188K probably damaging Het
Senp8 A G 9: 59,644,499 (GRCm39) I219T probably damaging Het
Serpinb10 A T 1: 107,468,630 (GRCm39) N91I probably damaging Het
Skint4 C T 4: 111,975,264 (GRCm39) R75C probably damaging Het
Slc25a48 C A 13: 56,612,825 (GRCm39) A241E probably damaging Het
Slc39a6 C A 18: 24,736,811 (GRCm39) probably benign Het
Smarcc1 G A 9: 110,002,972 (GRCm39) R354H probably damaging Het
Spata21 G C 4: 140,838,755 (GRCm39) probably null Het
Sptbn2 A G 19: 4,796,724 (GRCm39) E1774G possibly damaging Het
Tep1 A T 14: 51,082,894 (GRCm39) F1038Y possibly damaging Het
Thbs2 T A 17: 14,899,963 (GRCm39) D638V probably benign Het
Tmem161a G T 8: 70,627,047 (GRCm39) C33F probably damaging Het
Trim47 T C 11: 116,000,926 (GRCm39) S41G probably benign Het
Trim56 T A 5: 137,143,429 (GRCm39) H29L probably benign Het
Ugt2b35 T A 5: 87,156,064 (GRCm39) H385Q probably damaging Het
Ugt2b37 T A 5: 87,390,243 (GRCm39) H401L probably benign Het
Usp44 A C 10: 93,682,365 (GRCm39) T272P probably damaging Het
Usp46 C T 5: 74,189,897 (GRCm39) E156K probably benign Het
Vmn1r232 T C 17: 21,134,109 (GRCm39) K164E probably benign Het
Zan T A 5: 137,385,217 (GRCm39) N5072I unknown Het
Zfp318 T C 17: 46,723,576 (GRCm39) S1860P probably benign Het
Zfp616 C T 11: 73,975,710 (GRCm39) R660W probably benign Het
Zfp870 C T 17: 33,102,679 (GRCm39) V217I possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGATAAGAGAGCTCCTTG -3'
(R):5'- CTCAAAGGAGTGGACTGTCC -3'

Sequencing Primer
(F):5'- GCTCAGCAATGTCTCCCTGG -3'
(R):5'- GAGTTCCCTTGACCTGCACAG -3'
Posted On 2021-04-30