Incidental Mutation 'R8696:Csl'
ID668716
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R8696 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99758964 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 80 (Y80N)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056085
AA Change: Y80N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: Y80N

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,815,386 N423S probably benign Het
Adgrl4 T C 3: 151,542,707 L672P probably damaging Het
Akr1b10 C T 6: 34,392,132 T182I possibly damaging Het
Ankrd33 A G 15: 101,116,983 I84V probably benign Het
Arhgap32 A G 9: 32,248,503 Y272C possibly damaging Het
Arid4a T C 12: 71,063,316 S144P probably damaging Het
Bicd1 A G 6: 149,513,787 D666G probably damaging Het
Blk A T 14: 63,380,700 probably benign Het
Btbd2 C T 10: 80,644,681 R366Q possibly damaging Het
Cacna1i T C 15: 80,381,974 V1554A probably damaging Het
Camsap3 T C 8: 3,603,614 L428P probably damaging Het
Ccdc30 T G 4: 119,377,308 Y69S possibly damaging Het
Ccdc7a T A 8: 128,988,763 E280V probably damaging Het
Cdk11b T C 4: 155,648,322 V539A unknown Het
Ceacam3 A T 7: 17,160,012 N483Y Het
Cenpf C T 1: 189,657,997 A1213T probably benign Het
Chrna6 G T 8: 27,407,167 Y227* probably null Het
Cntnap5c A T 17: 58,294,299 D814V probably damaging Het
Ctsm A G 13: 61,537,707 L297P probably damaging Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dhx8 T C 11: 101,733,132 V31A unknown Het
Dis3l2 G T 1: 86,791,440 G131* probably null Het
Dkk1 G A 19: 30,549,288 A31V probably damaging Het
Dlx3 C T 11: 95,121,770 R130* probably null Het
Dnajc24 T C 2: 106,001,970 M23V probably benign Het
Dnmbp T A 19: 43,874,223 N76I probably damaging Het
Ezh1 T C 11: 101,209,479 N226S probably benign Het
Fabp9 C T 3: 10,193,987 V120M possibly damaging Het
Fcrlb A G 1: 170,912,079 C85R probably damaging Het
Gnai2 A C 9: 107,619,769 L131R Het
Gprin1 A G 13: 54,737,951 W837R probably damaging Het
Grm3 C T 5: 9,512,311 C513Y probably damaging Het
H60c T A 10: 3,260,265 I95F possibly damaging Het
Hecw1 A G 13: 14,357,158 V177A possibly damaging Het
Herc6 T A 6: 57,647,149 C635S probably benign Het
Itga4 A T 2: 79,281,781 M347L probably benign Het
Kif20b A G 19: 34,937,352 H436R probably benign Het
Klrg2 G T 6: 38,636,495 P191Q possibly damaging Het
Krt5 A G 15: 101,710,307 Y340H probably damaging Het
Map9 T A 3: 82,363,361 H77Q possibly damaging Het
Mfsd13a A G 19: 46,368,118 T221A probably benign Het
Myo10 C G 15: 25,799,486 H1378Q probably damaging Het
Nkx6-1 T C 5: 101,659,647 T290A possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Notch1 T A 2: 26,477,992 probably benign Het
Nr1d2 A T 14: 18,216,661 M169K probably damaging Het
Olfr1329 C T 4: 118,917,438 V10I probably benign Het
Olfr157 A G 4: 43,836,193 V99A probably benign Het
Olfr738 A G 14: 50,413,963 M140V possibly damaging Het
Olfr810 A T 10: 129,790,693 F299I possibly damaging Het
Olfr890 A G 9: 38,143,137 M1V probably null Het
Pdia6 T A 12: 17,279,661 I266K probably damaging Het
Phactr4 T C 4: 132,363,794 probably null Het
Polr1b T A 2: 129,125,651 L988Q probably damaging Het
Por A T 5: 135,734,258 M541L probably benign Het
Ppid T C 3: 79,591,382 probably benign Het
Prp2 A T 6: 132,600,359 Q203L unknown Het
Psme4 T G 11: 30,809,896 F340V probably damaging Het
Ptges2 T C 2: 32,400,065 S164P probably damaging Het
Rab18 G A 18: 6,788,635 G201S probably damaging Het
Rbm19 A G 5: 120,127,067 E391G probably damaging Het
Rcbtb2 T G 14: 73,166,865 V259G probably damaging Het
Rpn1 C A 6: 88,103,377 Q553K possibly damaging Het
Sash1 A G 10: 8,733,695 S697P probably damaging Het
Sdad1 T G 5: 92,289,786 H603P probably damaging Het
Serpini1 T C 3: 75,613,237 L47P probably damaging Het
Sorbs2 T A 8: 45,795,649 S646T possibly damaging Het
Spdye4a T A 5: 143,224,999 E105D probably benign Het
Srsf12 G A 4: 33,231,181 C230Y possibly damaging Het
Stard9 A T 2: 120,701,114 R2617S probably benign Het
Tas2r118 G T 6: 23,969,345 T239K probably damaging Het
Tlr1 A G 5: 64,926,751 L161P probably benign Het
Ttc21a T G 9: 119,943,911 V218G possibly damaging Het
Ttc6 T C 12: 57,737,706 S1854P probably benign Het
Unc93a A G 17: 13,122,965 L93P probably damaging Het
Vcan A T 13: 89,691,098 I2109N probably benign Het
Vmn1r225 A T 17: 20,503,157 S287C probably damaging Het
Vmn1r43 A G 6: 89,870,339 F55S probably damaging Het
Zfp72 A G 13: 74,372,480 Y160H probably damaging Het
Zfp772 T C 7: 7,205,519 T109A possibly damaging Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2284:Csl UTSW 10 99758459 missense possibly damaging 0.84
R2882:Csl UTSW 10 99758925 missense probably damaging 1.00
R4128:Csl UTSW 10 99758600 missense probably benign 0.02
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R5700:Csl UTSW 10 99759015 missense probably damaging 0.97
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8064:Csl UTSW 10 99758545 missense probably damaging 1.00
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATACCTGTTCCTCTGTGGG -3'
(R):5'- ATGGCTCTACTTACTGCGGC -3'

Sequencing Primer
(F):5'- GCATCTGTCCAGTTACCAGCAG -3'
(R):5'- TACTTACTGCGGCAGCCTG -3'
Posted On2021-04-30