Incidental Mutation 'R8696:Psme4'
ID668718
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8696 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30809896 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 340 (F340V)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: F340V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: F340V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,815,386 N423S probably benign Het
Adgrl4 T C 3: 151,542,707 L672P probably damaging Het
Akr1b10 C T 6: 34,392,132 T182I possibly damaging Het
Ankrd33 A G 15: 101,116,983 I84V probably benign Het
Arhgap32 A G 9: 32,248,503 Y272C possibly damaging Het
Arid4a T C 12: 71,063,316 S144P probably damaging Het
Bicd1 A G 6: 149,513,787 D666G probably damaging Het
Blk A T 14: 63,380,700 probably benign Het
Btbd2 C T 10: 80,644,681 R366Q possibly damaging Het
Cacna1i T C 15: 80,381,974 V1554A probably damaging Het
Camsap3 T C 8: 3,603,614 L428P probably damaging Het
Ccdc30 T G 4: 119,377,308 Y69S possibly damaging Het
Ccdc7a T A 8: 128,988,763 E280V probably damaging Het
Cdk11b T C 4: 155,648,322 V539A unknown Het
Ceacam3 A T 7: 17,160,012 N483Y Het
Cenpf C T 1: 189,657,997 A1213T probably benign Het
Chrna6 G T 8: 27,407,167 Y227* probably null Het
Cntnap5c A T 17: 58,294,299 D814V probably damaging Het
Csl A T 10: 99,758,964 Y80N probably damaging Het
Ctsm A G 13: 61,537,707 L297P probably damaging Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dhx8 T C 11: 101,733,132 V31A unknown Het
Dis3l2 G T 1: 86,791,440 G131* probably null Het
Dkk1 G A 19: 30,549,288 A31V probably damaging Het
Dlx3 C T 11: 95,121,770 R130* probably null Het
Dnajc24 T C 2: 106,001,970 M23V probably benign Het
Dnmbp T A 19: 43,874,223 N76I probably damaging Het
Ezh1 T C 11: 101,209,479 N226S probably benign Het
Fabp9 C T 3: 10,193,987 V120M possibly damaging Het
Fcrlb A G 1: 170,912,079 C85R probably damaging Het
Gnai2 A C 9: 107,619,769 L131R Het
Gprin1 A G 13: 54,737,951 W837R probably damaging Het
Grm3 C T 5: 9,512,311 C513Y probably damaging Het
H60c T A 10: 3,260,265 I95F possibly damaging Het
Hecw1 A G 13: 14,357,158 V177A possibly damaging Het
Herc6 T A 6: 57,647,149 C635S probably benign Het
Itga4 A T 2: 79,281,781 M347L probably benign Het
Kif20b A G 19: 34,937,352 H436R probably benign Het
Klrg2 G T 6: 38,636,495 P191Q possibly damaging Het
Krt5 A G 15: 101,710,307 Y340H probably damaging Het
Map9 T A 3: 82,363,361 H77Q possibly damaging Het
Mfsd13a A G 19: 46,368,118 T221A probably benign Het
Myo10 C G 15: 25,799,486 H1378Q probably damaging Het
Nkx6-1 T C 5: 101,659,647 T290A possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Notch1 T A 2: 26,477,992 probably benign Het
Nr1d2 A T 14: 18,216,661 M169K probably damaging Het
Olfr1329 C T 4: 118,917,438 V10I probably benign Het
Olfr157 A G 4: 43,836,193 V99A probably benign Het
Olfr738 A G 14: 50,413,963 M140V possibly damaging Het
Olfr810 A T 10: 129,790,693 F299I possibly damaging Het
Olfr890 A G 9: 38,143,137 M1V probably null Het
Pdia6 T A 12: 17,279,661 I266K probably damaging Het
Phactr4 T C 4: 132,363,794 probably null Het
Polr1b T A 2: 129,125,651 L988Q probably damaging Het
Por A T 5: 135,734,258 M541L probably benign Het
Ppid T C 3: 79,591,382 probably benign Het
Prp2 A T 6: 132,600,359 Q203L unknown Het
Ptges2 T C 2: 32,400,065 S164P probably damaging Het
Rab18 G A 18: 6,788,635 G201S probably damaging Het
Rbm19 A G 5: 120,127,067 E391G probably damaging Het
Rcbtb2 T G 14: 73,166,865 V259G probably damaging Het
Rpn1 C A 6: 88,103,377 Q553K possibly damaging Het
Sash1 A G 10: 8,733,695 S697P probably damaging Het
Sdad1 T G 5: 92,289,786 H603P probably damaging Het
Serpini1 T C 3: 75,613,237 L47P probably damaging Het
Sorbs2 T A 8: 45,795,649 S646T possibly damaging Het
Spdye4a T A 5: 143,224,999 E105D probably benign Het
Srsf12 G A 4: 33,231,181 C230Y possibly damaging Het
Stard9 A T 2: 120,701,114 R2617S probably benign Het
Tas2r118 G T 6: 23,969,345 T239K probably damaging Het
Tlr1 A G 5: 64,926,751 L161P probably benign Het
Ttc21a T G 9: 119,943,911 V218G possibly damaging Het
Ttc6 T C 12: 57,737,706 S1854P probably benign Het
Unc93a A G 17: 13,122,965 L93P probably damaging Het
Vcan A T 13: 89,691,098 I2109N probably benign Het
Vmn1r225 A T 17: 20,503,157 S287C probably damaging Het
Vmn1r43 A G 6: 89,870,339 F55S probably damaging Het
Zfp72 A G 13: 74,372,480 Y160H probably damaging Het
Zfp772 T C 7: 7,205,519 T109A possibly damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGTTTCAGGTACAACTGTTAC -3'
(R):5'- AAACTGGCGTGATGTGGCTATG -3'

Sequencing Primer
(F):5'- TCAGGTACAACTGTTACAATAAAGGG -3'
(R):5'- GTATGTACGTATGTCAAACACACAG -3'
Posted On2021-04-30