Incidental Mutation 'R8696:Vmn1r225'
ID668740
Institutional Source Beutler Lab
Gene Symbol Vmn1r225
Ensembl Gene ENSMUSG00000043537
Gene Namevomeronasal 1 receptor 225
SynonymsV1re5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8696 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20502299-20503195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20503157 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 287 (S287C)
Ref Sequence ENSEMBL: ENSMUSP00000056068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061660]
Predicted Effect probably damaging
Transcript: ENSMUST00000061660
AA Change: S287C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: S287C

DomainStartEndE-ValueType
Pfam:TAS2R 1 287 8.9e-15 PFAM
Pfam:V1R 11 291 3.1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,815,386 N423S probably benign Het
Adgrl4 T C 3: 151,542,707 L672P probably damaging Het
Akr1b10 C T 6: 34,392,132 T182I possibly damaging Het
Ankrd33 A G 15: 101,116,983 I84V probably benign Het
Arhgap32 A G 9: 32,248,503 Y272C possibly damaging Het
Arid4a T C 12: 71,063,316 S144P probably damaging Het
Bicd1 A G 6: 149,513,787 D666G probably damaging Het
Blk A T 14: 63,380,700 probably benign Het
Btbd2 C T 10: 80,644,681 R366Q possibly damaging Het
Cacna1i T C 15: 80,381,974 V1554A probably damaging Het
Camsap3 T C 8: 3,603,614 L428P probably damaging Het
Ccdc30 T G 4: 119,377,308 Y69S possibly damaging Het
Ccdc7a T A 8: 128,988,763 E280V probably damaging Het
Cdk11b T C 4: 155,648,322 V539A unknown Het
Ceacam3 A T 7: 17,160,012 N483Y Het
Cenpf C T 1: 189,657,997 A1213T probably benign Het
Chrna6 G T 8: 27,407,167 Y227* probably null Het
Cntnap5c A T 17: 58,294,299 D814V probably damaging Het
Csl A T 10: 99,758,964 Y80N probably damaging Het
Ctsm A G 13: 61,537,707 L297P probably damaging Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dhx8 T C 11: 101,733,132 V31A unknown Het
Dis3l2 G T 1: 86,791,440 G131* probably null Het
Dkk1 G A 19: 30,549,288 A31V probably damaging Het
Dlx3 C T 11: 95,121,770 R130* probably null Het
Dnajc24 T C 2: 106,001,970 M23V probably benign Het
Dnmbp T A 19: 43,874,223 N76I probably damaging Het
Ezh1 T C 11: 101,209,479 N226S probably benign Het
Fabp9 C T 3: 10,193,987 V120M possibly damaging Het
Fcrlb A G 1: 170,912,079 C85R probably damaging Het
Gnai2 A C 9: 107,619,769 L131R Het
Gprin1 A G 13: 54,737,951 W837R probably damaging Het
Grm3 C T 5: 9,512,311 C513Y probably damaging Het
H60c T A 10: 3,260,265 I95F possibly damaging Het
Hecw1 A G 13: 14,357,158 V177A possibly damaging Het
Herc6 T A 6: 57,647,149 C635S probably benign Het
Itga4 A T 2: 79,281,781 M347L probably benign Het
Kif20b A G 19: 34,937,352 H436R probably benign Het
Klrg2 G T 6: 38,636,495 P191Q possibly damaging Het
Krt5 A G 15: 101,710,307 Y340H probably damaging Het
Map9 T A 3: 82,363,361 H77Q possibly damaging Het
Mfsd13a A G 19: 46,368,118 T221A probably benign Het
Myo10 C G 15: 25,799,486 H1378Q probably damaging Het
Nkx6-1 T C 5: 101,659,647 T290A possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Notch1 T A 2: 26,477,992 probably benign Het
Nr1d2 A T 14: 18,216,661 M169K probably damaging Het
Olfr1329 C T 4: 118,917,438 V10I probably benign Het
Olfr157 A G 4: 43,836,193 V99A probably benign Het
Olfr738 A G 14: 50,413,963 M140V possibly damaging Het
Olfr810 A T 10: 129,790,693 F299I possibly damaging Het
Olfr890 A G 9: 38,143,137 M1V probably null Het
Pdia6 T A 12: 17,279,661 I266K probably damaging Het
Phactr4 T C 4: 132,363,794 probably null Het
Polr1b T A 2: 129,125,651 L988Q probably damaging Het
Por A T 5: 135,734,258 M541L probably benign Het
Ppid T C 3: 79,591,382 probably benign Het
Prp2 A T 6: 132,600,359 Q203L unknown Het
Psme4 T G 11: 30,809,896 F340V probably damaging Het
Ptges2 T C 2: 32,400,065 S164P probably damaging Het
Rab18 G A 18: 6,788,635 G201S probably damaging Het
Rbm19 A G 5: 120,127,067 E391G probably damaging Het
Rcbtb2 T G 14: 73,166,865 V259G probably damaging Het
Rpn1 C A 6: 88,103,377 Q553K possibly damaging Het
Sash1 A G 10: 8,733,695 S697P probably damaging Het
Sdad1 T G 5: 92,289,786 H603P probably damaging Het
Serpini1 T C 3: 75,613,237 L47P probably damaging Het
Sorbs2 T A 8: 45,795,649 S646T possibly damaging Het
Spdye4a T A 5: 143,224,999 E105D probably benign Het
Srsf12 G A 4: 33,231,181 C230Y possibly damaging Het
Stard9 A T 2: 120,701,114 R2617S probably benign Het
Tas2r118 G T 6: 23,969,345 T239K probably damaging Het
Tlr1 A G 5: 64,926,751 L161P probably benign Het
Ttc21a T G 9: 119,943,911 V218G possibly damaging Het
Ttc6 T C 12: 57,737,706 S1854P probably benign Het
Unc93a A G 17: 13,122,965 L93P probably damaging Het
Vcan A T 13: 89,691,098 I2109N probably benign Het
Vmn1r43 A G 6: 89,870,339 F55S probably damaging Het
Zfp72 A G 13: 74,372,480 Y160H probably damaging Het
Zfp772 T C 7: 7,205,519 T109A possibly damaging Het
Other mutations in Vmn1r225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Vmn1r225 APN 17 20502819 missense probably damaging 1.00
IGL01830:Vmn1r225 APN 17 20502455 missense probably damaging 0.96
IGL02943:Vmn1r225 APN 17 20502305 missense possibly damaging 0.67
R0544:Vmn1r225 UTSW 17 20502456 missense probably benign 0.44
R1126:Vmn1r225 UTSW 17 20502326 missense probably benign 0.03
R1809:Vmn1r225 UTSW 17 20502656 missense probably benign 0.04
R1928:Vmn1r225 UTSW 17 20502809 missense probably benign 0.00
R2044:Vmn1r225 UTSW 17 20502590 missense possibly damaging 0.50
R2191:Vmn1r225 UTSW 17 20502885 missense probably damaging 0.98
R2206:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2207:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2680:Vmn1r225 UTSW 17 20502793 missense probably benign 0.00
R3740:Vmn1r225 UTSW 17 20502999 missense possibly damaging 0.56
R3807:Vmn1r225 UTSW 17 20502852 nonsense probably null
R4196:Vmn1r225 UTSW 17 20502975 missense probably benign 0.00
R4970:Vmn1r225 UTSW 17 20502569 missense possibly damaging 0.74
R5129:Vmn1r225 UTSW 17 20503116 missense probably damaging 1.00
R5130:Vmn1r225 UTSW 17 20502785 missense possibly damaging 0.81
R5187:Vmn1r225 UTSW 17 20502915 missense probably damaging 0.96
R5580:Vmn1r225 UTSW 17 20502839 missense probably damaging 1.00
R6563:Vmn1r225 UTSW 17 20502501 missense probably benign 0.03
R6674:Vmn1r225 UTSW 17 20503115 missense probably benign 0.06
R7003:Vmn1r225 UTSW 17 20503154 missense probably null 0.01
R7143:Vmn1r225 UTSW 17 20502384 missense probably benign 0.22
R7422:Vmn1r225 UTSW 17 20502797 missense probably benign 0.25
R7651:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R7952:Vmn1r225 UTSW 17 20502327 missense probably damaging 0.98
R8097:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R8823:Vmn1r225 UTSW 17 20502561 missense probably benign 0.08
Z1177:Vmn1r225 UTSW 17 20502491 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTCTCCTGAAAACAGAGCCAC -3'
(R):5'- TACAACTGGTGAAGATCCTGTG -3'

Sequencing Primer
(F):5'- CACAGAAAATCCTCACCCTGGTTTG -3'
(R):5'- CTGGTGAAGATCCTGTGACTATAGAC -3'
Posted On2021-04-30