Incidental Mutation 'R8696:Dnmbp'
ID 668745
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43874223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 76 (N76I)
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026209
AA Change: N829I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: N829I

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212032
AA Change: N829I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212048
AA Change: N517I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212396
AA Change: N829I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212592
AA Change: N76I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,815,386 N423S probably benign Het
Adgrl4 T C 3: 151,542,707 L672P probably damaging Het
Akr1b10 C T 6: 34,392,132 T182I possibly damaging Het
Ankrd33 A G 15: 101,116,983 I84V probably benign Het
Arhgap32 A G 9: 32,248,503 Y272C possibly damaging Het
Arid4a T C 12: 71,063,316 S144P probably damaging Het
Bicd1 A G 6: 149,513,787 D666G probably damaging Het
Blk A T 14: 63,380,700 probably benign Het
Btbd2 C T 10: 80,644,681 R366Q possibly damaging Het
Cacna1i T C 15: 80,381,974 V1554A probably damaging Het
Camsap3 T C 8: 3,603,614 L428P probably damaging Het
Ccdc30 T G 4: 119,377,308 Y69S possibly damaging Het
Ccdc7a T A 8: 128,988,763 E280V probably damaging Het
Cdk11b T C 4: 155,648,322 V539A unknown Het
Ceacam3 A T 7: 17,160,012 N483Y Het
Cenpf C T 1: 189,657,997 A1213T probably benign Het
Chrna6 G T 8: 27,407,167 Y227* probably null Het
Cntnap5c A T 17: 58,294,299 D814V probably damaging Het
Csl A T 10: 99,758,964 Y80N probably damaging Het
Ctsm A G 13: 61,537,707 L297P probably damaging Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dhx8 T C 11: 101,733,132 V31A unknown Het
Dis3l2 G T 1: 86,791,440 G131* probably null Het
Dkk1 G A 19: 30,549,288 A31V probably damaging Het
Dlx3 C T 11: 95,121,770 R130* probably null Het
Dnajc24 T C 2: 106,001,970 M23V probably benign Het
Ezh1 T C 11: 101,209,479 N226S probably benign Het
Fabp9 C T 3: 10,193,987 V120M possibly damaging Het
Fcrlb A G 1: 170,912,079 C85R probably damaging Het
Gnai2 A C 9: 107,619,769 L131R Het
Gprin1 A G 13: 54,737,951 W837R probably damaging Het
Grm3 C T 5: 9,512,311 C513Y probably damaging Het
H60c T A 10: 3,260,265 I95F possibly damaging Het
Hecw1 A G 13: 14,357,158 V177A possibly damaging Het
Herc6 T A 6: 57,647,149 C635S probably benign Het
Itga4 A T 2: 79,281,781 M347L probably benign Het
Kif20b A G 19: 34,937,352 H436R probably benign Het
Klrg2 G T 6: 38,636,495 P191Q possibly damaging Het
Krt5 A G 15: 101,710,307 Y340H probably damaging Het
Map9 T A 3: 82,363,361 H77Q possibly damaging Het
Mfsd13a A G 19: 46,368,118 T221A probably benign Het
Myo10 C G 15: 25,799,486 H1378Q probably damaging Het
Nkx6-1 T C 5: 101,659,647 T290A possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Notch1 T A 2: 26,477,992 probably benign Het
Nr1d2 A T 14: 18,216,661 M169K probably damaging Het
Olfr1329 C T 4: 118,917,438 V10I probably benign Het
Olfr157 A G 4: 43,836,193 V99A probably benign Het
Olfr738 A G 14: 50,413,963 M140V possibly damaging Het
Olfr810 A T 10: 129,790,693 F299I possibly damaging Het
Olfr890 A G 9: 38,143,137 M1V probably null Het
Pdia6 T A 12: 17,279,661 I266K probably damaging Het
Phactr4 T C 4: 132,363,794 probably null Het
Polr1b T A 2: 129,125,651 L988Q probably damaging Het
Por A T 5: 135,734,258 M541L probably benign Het
Ppid T C 3: 79,591,382 probably benign Het
Prp2 A T 6: 132,600,359 Q203L unknown Het
Psme4 T G 11: 30,809,896 F340V probably damaging Het
Ptges2 T C 2: 32,400,065 S164P probably damaging Het
Rab18 G A 18: 6,788,635 G201S probably damaging Het
Rbm19 A G 5: 120,127,067 E391G probably damaging Het
Rcbtb2 T G 14: 73,166,865 V259G probably damaging Het
Rpn1 C A 6: 88,103,377 Q553K possibly damaging Het
Sash1 A G 10: 8,733,695 S697P probably damaging Het
Sdad1 T G 5: 92,289,786 H603P probably damaging Het
Serpini1 T C 3: 75,613,237 L47P probably damaging Het
Sorbs2 T A 8: 45,795,649 S646T possibly damaging Het
Spdye4a T A 5: 143,224,999 E105D probably benign Het
Srsf12 G A 4: 33,231,181 C230Y possibly damaging Het
Stard9 A T 2: 120,701,114 R2617S probably benign Het
Tas2r118 G T 6: 23,969,345 T239K probably damaging Het
Tlr1 A G 5: 64,926,751 L161P probably benign Het
Ttc21a T G 9: 119,943,911 V218G possibly damaging Het
Ttc6 T C 12: 57,737,706 S1854P probably benign Het
Unc93a A G 17: 13,122,965 L93P probably damaging Het
Vcan A T 13: 89,691,098 I2109N probably benign Het
Vmn1r225 A T 17: 20,503,157 S287C probably damaging Het
Vmn1r43 A G 6: 89,870,339 F55S probably damaging Het
Zfp72 A G 13: 74,372,480 Y160H probably damaging Het
Zfp772 T C 7: 7,205,519 T109A possibly damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAACATCAAAGCTGACTGAGG -3'
(R):5'- GGAGCCAGACTACAACTTAGGG -3'

Sequencing Primer
(F):5'- CATCAAAGCTGACTGAGGTAAAAG -3'
(R):5'- AAGGATGACACTAGAGATGGTTCTG -3'
Posted On 2021-04-30