Incidental Mutation 'R8697:Vwa3b'
ID 668748
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8697 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37076380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 308 (H308Q)
Ref Sequence ENSEMBL: ENSMUSP00000125460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000067178] [ENSMUST00000117172] [ENSMUST00000162449]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067178
AA Change: H308Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069700
Gene: ENSMUSG00000050122
AA Change: H308Q

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117172
AA Change: H308Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114022
Gene: ENSMUSG00000050122
AA Change: H308Q

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162449
AA Change: H308Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125460
Gene: ENSMUSG00000050122
AA Change: H308Q

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (58/59)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik C T 1: 161,967,996 A8T probably benign Het
Acacb T C 5: 114,213,380 V1130A probably damaging Het
Ackr1 A G 1: 173,332,208 F248S probably damaging Het
Alx4 G A 2: 93,675,312 R253Q probably damaging Het
Ap3b2 T C 7: 81,473,035 I485V possibly damaging Het
Aqp7 T C 4: 41,045,305 E25G probably damaging Het
Cacna1g T C 11: 94,416,698 N1753D probably benign Het
Cacna2d1 T A 5: 16,365,867 N1063K possibly damaging Het
Cad T C 5: 31,074,601 V1801A probably benign Het
Ccdc171 T C 4: 83,682,340 W868R probably damaging Het
Cecr2 T C 6: 120,733,818 Y165H probably damaging Het
Clip4 G T 17: 71,856,275 G614V possibly damaging Het
Ctnnal1 T A 4: 56,838,986 M236L probably damaging Het
Ctps T C 4: 120,542,750 D470G probably benign Het
Dmwd A C 7: 19,078,188 Q189P probably damaging Het
Dnah17 A G 11: 118,086,159 I1869T possibly damaging Het
Eepd1 A G 9: 25,586,702 N361S probably benign Het
Ephb6 C T 6: 41,614,223 H105Y probably damaging Het
Fkbp15 A T 4: 62,321,058 Y603* probably null Het
Flt3 T C 5: 147,358,001 Y420C possibly damaging Het
Frem2 T A 3: 53,525,828 T2692S probably damaging Het
Gna12 T A 5: 140,785,445 R157S probably benign Het
Gsdmc A T 15: 63,780,034 S243T probably benign Het
Hectd1 A G 12: 51,772,537 probably benign Het
Hoxd11 G A 2: 74,682,669 G93R unknown Het
Hydin A G 8: 110,532,883 I2496V probably benign Het
Igsf10 A G 3: 59,318,887 I2455T probably benign Het
Ilvbl A T 10: 78,583,362 R482* probably null Het
Itpr1 A G 6: 108,523,366 Y2640C probably damaging Het
Kif20a C G 18: 34,628,531 Q326E probably benign Het
Lamp1 A T 8: 13,174,448 M371L possibly damaging Het
Lcn6 A G 2: 25,677,154 N56D probably benign Het
Map3k10 A G 7: 27,663,359 V434A probably benign Het
Mdga1 T C 17: 29,846,641 N331S probably damaging Het
Mndal C A 1: 173,872,992 E138* probably null Het
Morc3 T C 16: 93,871,020 V762A probably benign Het
Ngef A T 1: 87,489,737 F279Y probably damaging Het
Olfr1026 A T 2: 85,923,856 K196I possibly damaging Het
Olfr455 A G 6: 42,538,695 V109A probably damaging Het
Padi4 GGAGCTCCTGA GGA 4: 140,757,919 probably null Het
Pcdhb4 G A 18: 37,308,779 V381M probably benign Het
Ppm1d T C 11: 85,337,160 Y301H possibly damaging Het
Rasgrf1 A G 9: 89,995,002 T807A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sipa1l2 T C 8: 125,482,116 K518E probably damaging Het
Slc52a3 A G 2: 152,004,476 D119G probably damaging Het
Srsf4 C T 4: 131,900,731 H379Y unknown Het
Ssr1 G T 13: 37,983,449 S246* probably null Het
Tars2 C T 3: 95,746,062 E509K possibly damaging Het
Tcrg-C2 A T 13: 19,307,344 M69K Het
Tepsin G T 11: 120,097,528 Y34* probably null Het
Tmtc2 A G 10: 105,369,970 I488T probably damaging Het
Ttc37 A G 13: 76,180,155 S1441G probably damaging Het
Ttn A G 2: 76,744,776 W25258R probably damaging Het
Utp14b T C 1: 78,666,527 M714T probably benign Het
Washc2 A G 6: 116,229,259 D480G probably benign Het
Xcl1 C T 1: 164,935,439 V18I unknown Het
Zcchc2 C A 1: 106,030,764 N988K probably damaging Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAACAGTGTTTGATGG -3'
(R):5'- CAACAACGGGACTTGTCTCC -3'

Sequencing Primer
(F):5'- GAATCACTTCGGTATCAGATCTGGC -3'
(R):5'- GTCTCCCACCAGGACACTTG -3'
Posted On 2021-04-30