Incidental Mutation 'R8697:Acacb'
ID 668774
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8697 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114146535-114250761 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114213380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1130 (V1130A)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: V1130A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V1130A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: V1130A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V1130A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik C T 1: 161,967,996 A8T probably benign Het
Ackr1 A G 1: 173,332,208 F248S probably damaging Het
Alx4 G A 2: 93,675,312 R253Q probably damaging Het
Ap3b2 T C 7: 81,473,035 I485V possibly damaging Het
Aqp7 T C 4: 41,045,305 E25G probably damaging Het
Cacna1g T C 11: 94,416,698 N1753D probably benign Het
Cacna2d1 T A 5: 16,365,867 N1063K possibly damaging Het
Cad T C 5: 31,074,601 V1801A probably benign Het
Ccdc171 T C 4: 83,682,340 W868R probably damaging Het
Cecr2 T C 6: 120,733,818 Y165H probably damaging Het
Clip4 G T 17: 71,856,275 G614V possibly damaging Het
Ctnnal1 T A 4: 56,838,986 M236L probably damaging Het
Ctps T C 4: 120,542,750 D470G probably benign Het
Dmwd A C 7: 19,078,188 Q189P probably damaging Het
Dnah17 A G 11: 118,086,159 I1869T possibly damaging Het
Eepd1 A G 9: 25,586,702 N361S probably benign Het
Ephb6 C T 6: 41,614,223 H105Y probably damaging Het
Fkbp15 A T 4: 62,321,058 Y603* probably null Het
Flt3 T C 5: 147,358,001 Y420C possibly damaging Het
Frem2 T A 3: 53,525,828 T2692S probably damaging Het
Gna12 T A 5: 140,785,445 R157S probably benign Het
Gsdmc A T 15: 63,780,034 S243T probably benign Het
Hectd1 A G 12: 51,772,537 probably benign Het
Hoxd11 G A 2: 74,682,669 G93R unknown Het
Hydin A G 8: 110,532,883 I2496V probably benign Het
Igsf10 A G 3: 59,318,887 I2455T probably benign Het
Ilvbl A T 10: 78,583,362 R482* probably null Het
Itpr1 A G 6: 108,523,366 Y2640C probably damaging Het
Kif20a C G 18: 34,628,531 Q326E probably benign Het
Lamp1 A T 8: 13,174,448 M371L possibly damaging Het
Lcn6 A G 2: 25,677,154 N56D probably benign Het
Map3k10 A G 7: 27,663,359 V434A probably benign Het
Mdga1 T C 17: 29,846,641 N331S probably damaging Het
Mndal C A 1: 173,872,992 E138* probably null Het
Morc3 T C 16: 93,871,020 V762A probably benign Het
Ngef A T 1: 87,489,737 F279Y probably damaging Het
Olfr1026 A T 2: 85,923,856 K196I possibly damaging Het
Olfr455 A G 6: 42,538,695 V109A probably damaging Het
Padi4 GGAGCTCCTGA GGA 4: 140,757,919 probably null Het
Pcdhb4 G A 18: 37,308,779 V381M probably benign Het
Ppm1d T C 11: 85,337,160 Y301H possibly damaging Het
Rasgrf1 A G 9: 89,995,002 T807A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sipa1l2 T C 8: 125,482,116 K518E probably damaging Het
Slc52a3 A G 2: 152,004,476 D119G probably damaging Het
Srsf4 C T 4: 131,900,731 H379Y unknown Het
Ssr1 G T 13: 37,983,449 S246* probably null Het
Tars2 C T 3: 95,746,062 E509K possibly damaging Het
Tcrg-C2 A T 13: 19,307,344 M69K Het
Tepsin G T 11: 120,097,528 Y34* probably null Het
Tmtc2 A G 10: 105,369,970 I488T probably damaging Het
Ttc37 A G 13: 76,180,155 S1441G probably damaging Het
Ttn A G 2: 76,744,776 W25258R probably damaging Het
Utp14b T C 1: 78,666,527 M714T probably benign Het
Vwa3b T A 1: 37,076,380 H308Q probably benign Het
Washc2 A G 6: 116,229,259 D480G probably benign Het
Xcl1 C T 1: 164,935,439 V18I unknown Het
Zcchc2 C A 1: 106,030,764 N988K probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
acetone UTSW 5 114226857 nonsense probably null
anabolism UTSW 5 114245220 missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
R8678:Acacb UTSW 5 114201971 nonsense probably null
R8693:Acacb UTSW 5 114226783 missense probably damaging 0.99
R8772:Acacb UTSW 5 114184118 missense possibly damaging 0.73
R8918:Acacb UTSW 5 114195254 missense probably damaging 1.00
R9044:Acacb UTSW 5 114235517 missense probably benign 0.00
R9165:Acacb UTSW 5 114216683 missense probably benign 0.01
R9231:Acacb UTSW 5 114211092 missense probably benign 0.01
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCAAGCATGGACCATCATG -3'
(R):5'- GAGTGAGTTCAGGACACCTACC -3'

Sequencing Primer
(F):5'- ATGGACCATCATGCCTGTG -3'
(R):5'- AGTTCAGGACACCTACCTCCCTG -3'
Posted On 2021-04-30