Mutagenetix > Incidental Mutations

Incidental Mutation 'R8697:Acacb'

668774

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8697 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114213380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1130 (V1130A)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031583
AA Change: V1130A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V1130A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102582
AA Change: V1130A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V1130A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	C	T	1: 161,967,996	A8T	probably benign	Het
Ackr1	A	G	1: 173,332,208	F248S	probably damaging	Het
Alx4	G	A	2: 93,675,312	R253Q	probably damaging	Het
Ap3b2	T	C	7: 81,473,035	I485V	possibly damaging	Het
Aqp7	T	C	4: 41,045,305	E25G	probably damaging	Het
Cacna1g	T	C	11: 94,416,698	N1753D	probably benign	Het
Cacna2d1	T	A	5: 16,365,867	N1063K	possibly damaging	Het
Cad	T	C	5: 31,074,601	V1801A	probably benign	Het
Ccdc171	T	C	4: 83,682,340	W868R	probably damaging	Het
Cecr2	T	C	6: 120,733,818	Y165H	probably damaging	Het
Clip4	G	T	17: 71,856,275	G614V	possibly damaging	Het
Ctnnal1	T	A	4: 56,838,986	M236L	probably damaging	Het
Ctps	T	C	4: 120,542,750	D470G	probably benign	Het
Dmwd	A	C	7: 19,078,188	Q189P	probably damaging	Het
Dnah17	A	G	11: 118,086,159	I1869T	possibly damaging	Het
Eepd1	A	G	9: 25,586,702	N361S	probably benign	Het
Ephb6	C	T	6: 41,614,223	H105Y	probably damaging	Het
Fkbp15	A	T	4: 62,321,058	Y603*	probably null	Het
Flt3	T	C	5: 147,358,001	Y420C	possibly damaging	Het
Frem2	T	A	3: 53,525,828	T2692S	probably damaging	Het
Gna12	T	A	5: 140,785,445	R157S	probably benign	Het
Gsdmc	A	T	15: 63,780,034	S243T	probably benign	Het
Hectd1	A	G	12: 51,772,537		probably benign	Het
Hoxd11	G	A	2: 74,682,669	G93R	unknown	Het
Hydin	A	G	8: 110,532,883	I2496V	probably benign	Het
Igsf10	A	G	3: 59,318,887	I2455T	probably benign	Het
Ilvbl	A	T	10: 78,583,362	R482*	probably null	Het
Itpr1	A	G	6: 108,523,366	Y2640C	probably damaging	Het
Kif20a	C	G	18: 34,628,531	Q326E	probably benign	Het
Lamp1	A	T	8: 13,174,448	M371L	possibly damaging	Het
Lcn6	A	G	2: 25,677,154	N56D	probably benign	Het
Map3k10	A	G	7: 27,663,359	V434A	probably benign	Het
Mdga1	T	C	17: 29,846,641	N331S	probably damaging	Het
Mndal	C	A	1: 173,872,992	E138*	probably null	Het
Morc3	T	C	16: 93,871,020	V762A	probably benign	Het
Ngef	A	T	1: 87,489,737	F279Y	probably damaging	Het
Olfr1026	A	T	2: 85,923,856	K196I	possibly damaging	Het
Olfr455	A	G	6: 42,538,695	V109A	probably damaging	Het
Padi4	GGAGCTCCTGA	GGA	4: 140,757,919		probably null	Het
Pcdhb4	G	A	18: 37,308,779	V381M	probably benign	Het
Ppm1d	T	C	11: 85,337,160	Y301H	possibly damaging	Het
Rasgrf1	A	G	9: 89,995,002	T807A	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Sipa1l2	T	C	8: 125,482,116	K518E	probably damaging	Het
Slc52a3	A	G	2: 152,004,476	D119G	probably damaging	Het
Srsf4	C	T	4: 131,900,731	H379Y	unknown	Het
Ssr1	G	T	13: 37,983,449	S246*	probably null	Het
Tars2	C	T	3: 95,746,062	E509K	possibly damaging	Het
Tcrg-C2	A	T	13: 19,307,344	M69K		Het
Tepsin	G	T	11: 120,097,528	Y34*	probably null	Het
Tmtc2	A	G	10: 105,369,970	I488T	probably damaging	Het
Ttc37	A	G	13: 76,180,155	S1441G	probably damaging	Het
Ttn	A	G	2: 76,744,776	W25258R	probably damaging	Het
Utp14b	T	C	1: 78,666,527	M714T	probably benign	Het
Vwa3b	T	A	1: 37,076,380	H308Q	probably benign	Het
Washc2	A	G	6: 116,229,259	D480G	probably benign	Het
Xcl1	C	T	1: 164,935,439	V18I	unknown	Het
Zcchc2	C	A	1: 106,030,764	N988K	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTGCAAGCATGGACCATCATG -3'
(R):5'- GAGTGAGTTCAGGACACCTACC -3'

Sequencing Primer
(F):5'- ATGGACCATCATGCCTGTG -3'
(R):5'- AGTTCAGGACACCTACCTCCCTG -3'

Posted On

2021-04-30