Incidental Mutation 'R8697:Ap3b2'
ID668785
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8697 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81473035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 485 (I485V)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082090
AA Change: I485V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I485V

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik C T 1: 161,967,996 A8T probably benign Het
Acacb T C 5: 114,213,380 V1130A probably damaging Het
Ackr1 A G 1: 173,332,208 F248S probably damaging Het
Alx4 G A 2: 93,675,312 R253Q probably damaging Het
Aqp7 T C 4: 41,045,305 E25G probably damaging Het
Cacna1g T C 11: 94,416,698 N1753D probably benign Het
Cacna2d1 T A 5: 16,365,867 N1063K possibly damaging Het
Cad T C 5: 31,074,601 V1801A probably benign Het
Ccdc171 T C 4: 83,682,340 W868R probably damaging Het
Cecr2 T C 6: 120,733,818 Y165H probably damaging Het
Clip4 G T 17: 71,856,275 G614V possibly damaging Het
Ctnnal1 T A 4: 56,838,986 M236L probably damaging Het
Ctps T C 4: 120,542,750 D470G probably benign Het
Dmwd A C 7: 19,078,188 Q189P probably damaging Het
Dnah17 A G 11: 118,086,159 I1869T possibly damaging Het
Eepd1 A G 9: 25,586,702 N361S probably benign Het
Ephb6 C T 6: 41,614,223 H105Y probably damaging Het
Fkbp15 A T 4: 62,321,058 Y603* probably null Het
Flt3 T C 5: 147,358,001 Y420C possibly damaging Het
Frem2 T A 3: 53,525,828 T2692S probably damaging Het
Gna12 T A 5: 140,785,445 R157S probably benign Het
Gsdmc A T 15: 63,780,034 S243T probably benign Het
Hectd1 A G 12: 51,772,537 probably benign Het
Hoxd11 G A 2: 74,682,669 G93R unknown Het
Hydin A G 8: 110,532,883 I2496V probably benign Het
Igsf10 A G 3: 59,318,887 I2455T probably benign Het
Ilvbl A T 10: 78,583,362 R482* probably null Het
Itpr1 A G 6: 108,523,366 Y2640C probably damaging Het
Kif20a C G 18: 34,628,531 Q326E probably benign Het
Lamp1 A T 8: 13,174,448 M371L possibly damaging Het
Lcn6 A G 2: 25,677,154 N56D probably benign Het
Map3k10 A G 7: 27,663,359 V434A probably benign Het
Mdga1 T C 17: 29,846,641 N331S probably damaging Het
Mndal C A 1: 173,872,992 E138* probably null Het
Morc3 T C 16: 93,871,020 V762A probably benign Het
Ngef A T 1: 87,489,737 F279Y probably damaging Het
Olfr1026 A T 2: 85,923,856 K196I possibly damaging Het
Olfr455 A G 6: 42,538,695 V109A probably damaging Het
Padi4 GGAGCTCCTGA GGA 4: 140,757,919 probably null Het
Pcdhb4 G A 18: 37,308,779 V381M probably benign Het
Ppm1d T C 11: 85,337,160 Y301H possibly damaging Het
Rasgrf1 A G 9: 89,995,002 T807A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sipa1l2 T C 8: 125,482,116 K518E probably damaging Het
Slc52a3 A G 2: 152,004,476 D119G probably damaging Het
Srsf4 C T 4: 131,900,731 H379Y unknown Het
Ssr1 G T 13: 37,983,449 S246* probably null Het
Tars2 C T 3: 95,746,062 E509K possibly damaging Het
Tcrg-C2 A T 13: 19,307,344 M69K Het
Tepsin G T 11: 120,097,528 Y34* probably null Het
Tmtc2 A G 10: 105,369,970 I488T probably damaging Het
Ttc37 A G 13: 76,180,155 S1441G probably damaging Het
Ttn A G 2: 76,744,776 W25258R probably damaging Het
Utp14b T C 1: 78,666,527 M714T probably benign Het
Vwa3b T A 1: 37,076,380 H308Q probably benign Het
Washc2 A G 6: 116,229,259 D480G probably benign Het
Xcl1 C T 1: 164,935,439 V18I unknown Het
Zcchc2 C A 1: 106,030,764 N988K probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGTGCCCATTTGGAG -3'
(R):5'- CTGAGCTGTTTGAGAATTGCAG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- TTGAGAATTGCAGGGGGC -3'
Posted On2021-04-30