Incidental Mutation 'R8697:Ap3b2'
ID 668785
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 068551-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8697 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81122783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 485 (I485V)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect possibly damaging
Transcript: ENSMUST00000082090
AA Change: I485V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I485V

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik C T 1: 161,795,565 (GRCm39) A8T probably benign Het
Acacb T C 5: 114,351,441 (GRCm39) V1130A probably damaging Het
Ackr1 A G 1: 173,159,775 (GRCm39) F248S probably damaging Het
Alx4 G A 2: 93,505,657 (GRCm39) R253Q probably damaging Het
Aqp7 T C 4: 41,045,305 (GRCm39) E25G probably damaging Het
Cacna1g T C 11: 94,307,524 (GRCm39) N1753D probably benign Het
Cacna2d1 T A 5: 16,570,865 (GRCm39) N1063K possibly damaging Het
Cad T C 5: 31,231,945 (GRCm39) V1801A probably benign Het
Ccdc171 T C 4: 83,600,577 (GRCm39) W868R probably damaging Het
Cecr2 T C 6: 120,710,779 (GRCm39) Y165H probably damaging Het
Clip4 G T 17: 72,163,270 (GRCm39) G614V possibly damaging Het
Ctnnal1 T A 4: 56,838,986 (GRCm39) M236L probably damaging Het
Ctps1 T C 4: 120,399,947 (GRCm39) D470G probably benign Het
Dmwd A C 7: 18,812,113 (GRCm39) Q189P probably damaging Het
Dnah17 A G 11: 117,976,985 (GRCm39) I1869T possibly damaging Het
Eepd1 A G 9: 25,497,998 (GRCm39) N361S probably benign Het
Ephb6 C T 6: 41,591,157 (GRCm39) H105Y probably damaging Het
Fkbp15 A T 4: 62,239,295 (GRCm39) Y603* probably null Het
Flt3 T C 5: 147,294,811 (GRCm39) Y420C possibly damaging Het
Frem2 T A 3: 53,433,249 (GRCm39) T2692S probably damaging Het
Gna12 T A 5: 140,771,200 (GRCm39) R157S probably benign Het
Gsdmc A T 15: 63,651,883 (GRCm39) S243T probably benign Het
Hectd1 A G 12: 51,819,320 (GRCm39) probably benign Het
Hoxd11 G A 2: 74,513,013 (GRCm39) G93R unknown Het
Hydin A G 8: 111,259,515 (GRCm39) I2496V probably benign Het
Igsf10 A G 3: 59,226,308 (GRCm39) I2455T probably benign Het
Ilvbl A T 10: 78,419,196 (GRCm39) R482* probably null Het
Itpr1 A G 6: 108,500,327 (GRCm39) Y2640C probably damaging Het
Kif20a C G 18: 34,761,584 (GRCm39) Q326E probably benign Het
Lamp1 A T 8: 13,224,448 (GRCm39) M371L possibly damaging Het
Lcn6 A G 2: 25,567,166 (GRCm39) N56D probably benign Het
Map3k10 A G 7: 27,362,784 (GRCm39) V434A probably benign Het
Mdga1 T C 17: 30,065,615 (GRCm39) N331S probably damaging Het
Mndal C A 1: 173,700,558 (GRCm39) E138* probably null Het
Morc3 T C 16: 93,667,908 (GRCm39) V762A probably benign Het
Ngef A T 1: 87,417,459 (GRCm39) F279Y probably damaging Het
Or10ac1 A G 6: 42,515,629 (GRCm39) V109A probably damaging Het
Or5m13b A T 2: 85,754,200 (GRCm39) K196I possibly damaging Het
Padi4 GGAGCTCCTGA GGA 4: 140,485,230 (GRCm39) probably null Het
Pcdhb4 G A 18: 37,441,832 (GRCm39) V381M probably benign Het
Ppm1d T C 11: 85,227,986 (GRCm39) Y301H possibly damaging Het
Rasgrf1 A G 9: 89,877,055 (GRCm39) T807A probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Sipa1l2 T C 8: 126,208,855 (GRCm39) K518E probably damaging Het
Skic3 A G 13: 76,328,274 (GRCm39) S1441G probably damaging Het
Slc52a3 A G 2: 151,846,396 (GRCm39) D119G probably damaging Het
Srsf4 C T 4: 131,628,042 (GRCm39) H379Y unknown Het
Ssr1 G T 13: 38,167,425 (GRCm39) S246* probably null Het
Tars2 C T 3: 95,653,374 (GRCm39) E509K possibly damaging Het
Tepsin G T 11: 119,988,354 (GRCm39) Y34* probably null Het
Tmtc2 A G 10: 105,205,831 (GRCm39) I488T probably damaging Het
Trgc2 A T 13: 19,491,514 (GRCm39) M69K Het
Ttn A G 2: 76,575,120 (GRCm39) W25258R probably damaging Het
Utp14b T C 1: 78,644,244 (GRCm39) M714T probably benign Het
Vwa3b T A 1: 37,115,461 (GRCm39) H308Q probably benign Het
Washc2 A G 6: 116,206,220 (GRCm39) D480G probably benign Het
Xcl1 C T 1: 164,763,008 (GRCm39) V18I unknown Het
Zcchc2 C A 1: 105,958,494 (GRCm39) N988K probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGTGCCCATTTGGAG -3'
(R):5'- CTGAGCTGTTTGAGAATTGCAG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- TTGAGAATTGCAGGGGGC -3'
Posted On 2021-04-30