Mutagenetix > Incidental Mutation

Incidental Mutation 'R8697:Ap3b2'

668785

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8697 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81473035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 485 (I485V)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082090
AA Change: I485V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I485V

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	C	T	1: 161,967,996	A8T	probably benign	Het
Acacb	T	C	5: 114,213,380	V1130A	probably damaging	Het
Ackr1	A	G	1: 173,332,208	F248S	probably damaging	Het
Alx4	G	A	2: 93,675,312	R253Q	probably damaging	Het
Aqp7	T	C	4: 41,045,305	E25G	probably damaging	Het
Cacna1g	T	C	11: 94,416,698	N1753D	probably benign	Het
Cacna2d1	T	A	5: 16,365,867	N1063K	possibly damaging	Het
Cad	T	C	5: 31,074,601	V1801A	probably benign	Het
Ccdc171	T	C	4: 83,682,340	W868R	probably damaging	Het
Cecr2	T	C	6: 120,733,818	Y165H	probably damaging	Het
Clip4	G	T	17: 71,856,275	G614V	possibly damaging	Het
Ctnnal1	T	A	4: 56,838,986	M236L	probably damaging	Het
Ctps	T	C	4: 120,542,750	D470G	probably benign	Het
Dmwd	A	C	7: 19,078,188	Q189P	probably damaging	Het
Dnah17	A	G	11: 118,086,159	I1869T	possibly damaging	Het
Eepd1	A	G	9: 25,586,702	N361S	probably benign	Het
Ephb6	C	T	6: 41,614,223	H105Y	probably damaging	Het
Fkbp15	A	T	4: 62,321,058	Y603*	probably null	Het
Flt3	T	C	5: 147,358,001	Y420C	possibly damaging	Het
Frem2	T	A	3: 53,525,828	T2692S	probably damaging	Het
Gna12	T	A	5: 140,785,445	R157S	probably benign	Het
Gsdmc	A	T	15: 63,780,034	S243T	probably benign	Het
Hectd1	A	G	12: 51,772,537		probably benign	Het
Hoxd11	G	A	2: 74,682,669	G93R	unknown	Het
Hydin	A	G	8: 110,532,883	I2496V	probably benign	Het
Igsf10	A	G	3: 59,318,887	I2455T	probably benign	Het
Ilvbl	A	T	10: 78,583,362	R482*	probably null	Het
Itpr1	A	G	6: 108,523,366	Y2640C	probably damaging	Het
Kif20a	C	G	18: 34,628,531	Q326E	probably benign	Het
Lamp1	A	T	8: 13,174,448	M371L	possibly damaging	Het
Lcn6	A	G	2: 25,677,154	N56D	probably benign	Het
Map3k10	A	G	7: 27,663,359	V434A	probably benign	Het
Mdga1	T	C	17: 29,846,641	N331S	probably damaging	Het
Mndal	C	A	1: 173,872,992	E138*	probably null	Het
Morc3	T	C	16: 93,871,020	V762A	probably benign	Het
Ngef	A	T	1: 87,489,737	F279Y	probably damaging	Het
Olfr1026	A	T	2: 85,923,856	K196I	possibly damaging	Het
Olfr455	A	G	6: 42,538,695	V109A	probably damaging	Het
Padi4	GGAGCTCCTGA	GGA	4: 140,757,919		probably null	Het
Pcdhb4	G	A	18: 37,308,779	V381M	probably benign	Het
Ppm1d	T	C	11: 85,337,160	Y301H	possibly damaging	Het
Rasgrf1	A	G	9: 89,995,002	T807A	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Sipa1l2	T	C	8: 125,482,116	K518E	probably damaging	Het
Slc52a3	A	G	2: 152,004,476	D119G	probably damaging	Het
Srsf4	C	T	4: 131,900,731	H379Y	unknown	Het
Ssr1	G	T	13: 37,983,449	S246*	probably null	Het
Tars2	C	T	3: 95,746,062	E509K	possibly damaging	Het
Tcrg-C2	A	T	13: 19,307,344	M69K		Het
Tepsin	G	T	11: 120,097,528	Y34*	probably null	Het
Tmtc2	A	G	10: 105,369,970	I488T	probably damaging	Het
Ttc37	A	G	13: 76,180,155	S1441G	probably damaging	Het
Ttn	A	G	2: 76,744,776	W25258R	probably damaging	Het
Utp14b	T	C	1: 78,666,527	M714T	probably benign	Het
Vwa3b	T	A	1: 37,076,380	H308Q	probably benign	Het
Washc2	A	G	6: 116,229,259	D480G	probably benign	Het
Xcl1	C	T	1: 164,935,439	V18I	unknown	Het
Zcchc2	C	A	1: 106,030,764	N988K	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGCAGTGCCCATTTGGAG -3'
(R):5'- CTGAGCTGTTTGAGAATTGCAG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- TTGAGAATTGCAGGGGGC -3'

Posted On

2021-04-30