Incidental Mutation 'R8698:Cntnap2'
ID 668839
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8698 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47049222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 935 (G935D)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: G935D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: G935D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150737
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,815 probably benign Het
Adamtsl1 A G 4: 86,388,477 N1384S probably benign Het
Adgre1 T C 17: 57,402,003 S65P probably benign Het
Adgrl4 G T 3: 151,497,875 C124F probably damaging Het
Aldh1b1 G A 4: 45,802,942 G160D probably damaging Het
Alpi T G 1: 87,100,486 D205A probably damaging Het
AW146154 C A 7: 41,480,510 R394L probably benign Het
Bcl10 G A 3: 145,933,267 M221I probably benign Het
Brpf3 G A 17: 28,818,462 R768H probably damaging Het
Cad G T 5: 31,077,475 R2116L probably benign Het
Cand2 G T 6: 115,786,891 R258L probably damaging Het
Car4 A T 11: 84,964,183 N119I probably benign Het
Carmil1 C T 13: 24,036,246 G1165D probably damaging Het
Ccdc66 T C 14: 27,490,690 T403A probably benign Het
Cdon T G 9: 35,486,973 probably null Het
Cemip T C 7: 83,958,582 I739V probably damaging Het
Cep85l A G 10: 53,358,105 I59T probably damaging Het
Clec4f A T 6: 83,653,285 V97D probably benign Het
Cnot6l A G 5: 96,077,290 C515R probably damaging Het
Cntrl A G 2: 35,133,962 H553R probably damaging Het
Cops3 A G 11: 59,818,060 S423P probably damaging Het
Cox15 C T 19: 43,751,509 R39H probably benign Het
Ctnna2 A G 6: 77,653,117 V131A probably benign Het
Dcst2 T A 3: 89,368,737 F392I probably benign Het
Decr1 A G 4: 15,922,483 probably null Het
Dennd3 A C 15: 73,522,305 T60P possibly damaging Het
Dmxl2 T C 9: 54,374,669 N2859S probably benign Het
Dnah12 A T 14: 26,707,263 I280F probably benign Het
Dnah8 A C 17: 30,875,035 D4701A probably damaging Het
Dyrk1a C A 16: 94,686,555 H541Q possibly damaging Het
Eml4 T C 17: 83,477,916 S906P probably benign Het
Fam129c T A 8: 71,607,515 I93N unknown Het
Fam169a G T 13: 97,107,070 V203F probably damaging Het
Fam69a A T 5: 107,909,910 F261I probably damaging Het
Fmn1 C T 2: 113,429,807 L682F unknown Het
Gli2 T C 1: 118,842,157 Y555C probably damaging Het
Gm3278 A G 14: 4,894,467 Y130C possibly damaging Het
Gm8237 T A 14: 5,863,554 Y37F probably damaging Het
Golga4 T G 9: 118,555,961 L717R probably damaging Het
Gtpbp4 C T 13: 8,974,213 R568H probably benign Het
Il1f10 A G 2: 24,293,185 N47S probably damaging Het
Itga6 A G 2: 71,843,274 H884R probably benign Het
Kdm1a T C 4: 136,559,207 K482R probably benign Het
Klk12 T C 7: 43,769,689 V26A probably benign Het
Lrp2 T A 2: 69,448,239 R3923S probably benign Het
Lrp2 C T 2: 69,458,423 V3700M probably benign Het
Lrrk2 A G 15: 91,752,197 D1458G probably benign Het
Mapre2 T A 18: 23,878,033 S233T probably benign Het
Mki67 T C 7: 135,695,208 D2699G possibly damaging Het
Mthfr T A 4: 148,044,490 Y214* probably null Het
Ncoa6 A T 2: 155,415,121 M834K possibly damaging Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Olfr1535 G A 13: 21,555,720 L101F probably damaging Het
Olfr344 T C 2: 36,568,903 Y102H possibly damaging Het
Olfr698 A T 7: 106,753,364 V8E probably benign Het
P2ry14 A G 3: 59,115,175 V288A possibly damaging Het
Pde6b G T 5: 108,428,239 S730I possibly damaging Het
Pdpk1 A T 17: 24,079,568 V496D probably damaging Het
Plekho2 A T 9: 65,556,272 L432M probably damaging Het
Ppa2 T C 3: 133,376,601 L151P unknown Het
Ppp2r3c G A 12: 55,281,714 T422I probably benign Het
Prelid3a T C 18: 67,477,052 S151P probably damaging Het
Rad21l G A 2: 151,645,453 P537L probably damaging Het
Sacs T A 14: 61,213,353 S4283T probably benign Het
Samd9l A T 6: 3,373,843 D1139E probably benign Het
Scn9a G T 2: 66,536,284 H718Q probably benign Het
Slc1a3 A T 15: 8,639,152 I443N probably damaging Het
Slc22a6 A G 19: 8,623,525 M361V probably benign Het
Slc8a2 A G 7: 16,157,207 Y724C probably damaging Het
Slf1 A T 13: 77,049,165 S777T possibly damaging Het
Sltm T C 9: 70,587,070 S901P probably benign Het
Smc1b A T 15: 85,112,846 H524Q probably benign Het
Spast T C 17: 74,359,346 S225P probably benign Het
Srsf12 C T 4: 33,231,246 R252W probably damaging Het
Syne1 A G 10: 5,229,229 L4415P probably damaging Het
Tmem117 A T 15: 94,638,109 Y8F probably benign Het
Tmem241 T C 18: 12,064,231 D180G possibly damaging Het
Tomm40 C T 7: 19,710,965 V164I probably benign Het
Ttc41 T C 10: 86,712,977 Y12H probably benign Het
Twnk T C 19: 45,007,860 V244A probably benign Het
Ugt1a8 T C 1: 88,088,230 S122P probably damaging Het
Vmn1r78 A G 7: 12,152,612 K50R probably benign Het
Vmn2r10 A G 5: 109,003,524 F75L probably benign Het
Wbp4 G T 14: 79,470,133 Y179* probably null Het
Zfp106 A G 2: 120,524,119 probably null Het
Zfp974 A T 7: 27,910,936 C455S possibly damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTTTAGACAGGACCAACTCG -3'
(R):5'- GGACTGGAAGTTGTCTCTGC -3'

Sequencing Primer
(F):5'- TGTTTAGACAGGACCAACTCGAAAGG -3'
(R):5'- CAGAATGTCCCATCATAGGCTGTG -3'
Posted On 2021-04-30