Incidental Mutation 'R8698:AW146154'
ID668847
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Nameexpressed sequence AW146154
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8698 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41478874-41499890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41480510 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 394 (R394L)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000098509
AA Change: R394L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: R394L

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,815 probably benign Het
Adamtsl1 A G 4: 86,388,477 N1384S probably benign Het
Adgre1 T C 17: 57,402,003 S65P probably benign Het
Adgrl4 G T 3: 151,497,875 C124F probably damaging Het
Aldh1b1 G A 4: 45,802,942 G160D probably damaging Het
Alpi T G 1: 87,100,486 D205A probably damaging Het
Bcl10 G A 3: 145,933,267 M221I probably benign Het
Brpf3 G A 17: 28,818,462 R768H probably damaging Het
Cad G T 5: 31,077,475 R2116L probably benign Het
Cand2 G T 6: 115,786,891 R258L probably damaging Het
Car4 A T 11: 84,964,183 N119I probably benign Het
Carmil1 C T 13: 24,036,246 G1165D probably damaging Het
Ccdc66 T C 14: 27,490,690 T403A probably benign Het
Cdon T G 9: 35,486,973 probably null Het
Cemip T C 7: 83,958,582 I739V probably damaging Het
Cep85l A G 10: 53,358,105 I59T probably damaging Het
Clec4f A T 6: 83,653,285 V97D probably benign Het
Cnot6l A G 5: 96,077,290 C515R probably damaging Het
Cntnap2 G A 6: 47,049,222 G935D probably damaging Het
Cntrl A G 2: 35,133,962 H553R probably damaging Het
Cops3 A G 11: 59,818,060 S423P probably damaging Het
Cox15 C T 19: 43,751,509 R39H probably benign Het
Ctnna2 A G 6: 77,653,117 V131A probably benign Het
Dcst2 T A 3: 89,368,737 F392I probably benign Het
Decr1 A G 4: 15,922,483 probably null Het
Dennd3 A C 15: 73,522,305 T60P possibly damaging Het
Dmxl2 T C 9: 54,374,669 N2859S probably benign Het
Dnah12 A T 14: 26,707,263 I280F probably benign Het
Dnah8 A C 17: 30,875,035 D4701A probably damaging Het
Dyrk1a C A 16: 94,686,555 H541Q possibly damaging Het
Eml4 T C 17: 83,477,916 S906P probably benign Het
Fam129c T A 8: 71,607,515 I93N unknown Het
Fam169a G T 13: 97,107,070 V203F probably damaging Het
Fam69a A T 5: 107,909,910 F261I probably damaging Het
Fmn1 C T 2: 113,429,807 L682F unknown Het
Gli2 T C 1: 118,842,157 Y555C probably damaging Het
Gm3278 A G 14: 4,894,467 Y130C possibly damaging Het
Gm8237 T A 14: 5,863,554 Y37F probably damaging Het
Golga4 T G 9: 118,555,961 L717R probably damaging Het
Gtpbp4 C T 13: 8,974,213 R568H probably benign Het
Il1f10 A G 2: 24,293,185 N47S probably damaging Het
Itga6 A G 2: 71,843,274 H884R probably benign Het
Kdm1a T C 4: 136,559,207 K482R probably benign Het
Klk12 T C 7: 43,769,689 V26A probably benign Het
Lrp2 T A 2: 69,448,239 R3923S probably benign Het
Lrp2 C T 2: 69,458,423 V3700M probably benign Het
Lrrk2 A G 15: 91,752,197 D1458G probably benign Het
Mapre2 T A 18: 23,878,033 S233T probably benign Het
Mki67 T C 7: 135,695,208 D2699G possibly damaging Het
Mthfr T A 4: 148,044,490 Y214* probably null Het
Ncoa6 A T 2: 155,415,121 M834K possibly damaging Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Olfr1535 G A 13: 21,555,720 L101F probably damaging Het
Olfr344 T C 2: 36,568,903 Y102H possibly damaging Het
Olfr698 A T 7: 106,753,364 V8E probably benign Het
P2ry14 A G 3: 59,115,175 V288A possibly damaging Het
Pde6b G T 5: 108,428,239 S730I possibly damaging Het
Pdpk1 A T 17: 24,079,568 V496D probably damaging Het
Plekho2 A T 9: 65,556,272 L432M probably damaging Het
Ppa2 T C 3: 133,376,601 L151P unknown Het
Ppp2r3c G A 12: 55,281,714 T422I probably benign Het
Prelid3a T C 18: 67,477,052 S151P probably damaging Het
Rad21l G A 2: 151,645,453 P537L probably damaging Het
Sacs T A 14: 61,213,353 S4283T probably benign Het
Samd9l A T 6: 3,373,843 D1139E probably benign Het
Scn9a G T 2: 66,536,284 H718Q probably benign Het
Slc1a3 A T 15: 8,639,152 I443N probably damaging Het
Slc22a6 A G 19: 8,623,525 M361V probably benign Het
Slc8a2 A G 7: 16,157,207 Y724C probably damaging Het
Slf1 A T 13: 77,049,165 S777T possibly damaging Het
Sltm T C 9: 70,587,070 S901P probably benign Het
Smc1b A T 15: 85,112,846 H524Q probably benign Het
Spast T C 17: 74,359,346 S225P probably benign Het
Srsf12 C T 4: 33,231,246 R252W probably damaging Het
Syne1 A G 10: 5,229,229 L4415P probably damaging Het
Tmem117 A T 15: 94,638,109 Y8F probably benign Het
Tmem241 T C 18: 12,064,231 D180G possibly damaging Het
Tomm40 C T 7: 19,710,965 V164I probably benign Het
Ttc41 T C 10: 86,712,977 Y12H probably benign Het
Twnk T C 19: 45,007,860 V244A probably benign Het
Ugt1a8 T C 1: 88,088,230 S122P probably damaging Het
Vmn1r78 A G 7: 12,152,612 K50R probably benign Het
Vmn2r10 A G 5: 109,003,524 F75L probably benign Het
Wbp4 G T 14: 79,470,133 Y179* probably null Het
Zfp106 A G 2: 120,524,119 probably null Het
Zfp974 A T 7: 27,910,936 C455S possibly damaging Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41480459 missense probably damaging 1.00
R1351:AW146154 UTSW 7 41480454 missense probably damaging 1.00
R3763:AW146154 UTSW 7 41480370 missense probably damaging 1.00
R4829:AW146154 UTSW 7 41480633 missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41480468 missense probably damaging 1.00
R5326:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5542:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5976:AW146154 UTSW 7 41480297 missense probably damaging 0.99
R6252:AW146154 UTSW 7 41481387 missense probably benign 0.10
R7006:AW146154 UTSW 7 41481224 missense possibly damaging 0.50
R7053:AW146154 UTSW 7 41482564 critical splice donor site probably null
R7096:AW146154 UTSW 7 41481443 missense probably benign 0.32
R7649:AW146154 UTSW 7 41480732 missense probably benign 0.13
R8069:AW146154 UTSW 7 41480511 missense probably benign 0.01
R8085:AW146154 UTSW 7 41481197 missense possibly damaging 0.61
R8085:AW146154 UTSW 7 41481198 missense probably damaging 1.00
R8266:AW146154 UTSW 7 41481168 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAAACTACTGTGATATGCAAAGGC -3'
(R):5'- CTTTACCCGGCACAATAGTCTC -3'

Sequencing Primer
(F):5'- TCTCTGCAGTATGAATTGGCTC -3'
(R):5'- CGGCACAATAGTCTCCAAATAC -3'
Posted On2021-04-30