Incidental Mutation 'R8698:Ttc41'
ID 668860
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8698 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86712977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 12 (Y12H)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061458
AA Change: Y12H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: Y12H

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: Y12H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: Y12H

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217747
AA Change: Y12H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: Y12H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,815 probably benign Het
Adamtsl1 A G 4: 86,388,477 N1384S probably benign Het
Adgre1 T C 17: 57,402,003 S65P probably benign Het
Adgrl4 G T 3: 151,497,875 C124F probably damaging Het
Aldh1b1 G A 4: 45,802,942 G160D probably damaging Het
Alpi T G 1: 87,100,486 D205A probably damaging Het
AW146154 C A 7: 41,480,510 R394L probably benign Het
Bcl10 G A 3: 145,933,267 M221I probably benign Het
Brpf3 G A 17: 28,818,462 R768H probably damaging Het
Cad G T 5: 31,077,475 R2116L probably benign Het
Cand2 G T 6: 115,786,891 R258L probably damaging Het
Car4 A T 11: 84,964,183 N119I probably benign Het
Carmil1 C T 13: 24,036,246 G1165D probably damaging Het
Ccdc66 T C 14: 27,490,690 T403A probably benign Het
Cdon T G 9: 35,486,973 probably null Het
Cemip T C 7: 83,958,582 I739V probably damaging Het
Cep85l A G 10: 53,358,105 I59T probably damaging Het
Clec4f A T 6: 83,653,285 V97D probably benign Het
Cnot6l A G 5: 96,077,290 C515R probably damaging Het
Cntnap2 G A 6: 47,049,222 G935D probably damaging Het
Cntrl A G 2: 35,133,962 H553R probably damaging Het
Cops3 A G 11: 59,818,060 S423P probably damaging Het
Cox15 C T 19: 43,751,509 R39H probably benign Het
Ctnna2 A G 6: 77,653,117 V131A probably benign Het
Dcst2 T A 3: 89,368,737 F392I probably benign Het
Decr1 A G 4: 15,922,483 probably null Het
Dennd3 A C 15: 73,522,305 T60P possibly damaging Het
Dmxl2 T C 9: 54,374,669 N2859S probably benign Het
Dnah12 A T 14: 26,707,263 I280F probably benign Het
Dnah8 A C 17: 30,875,035 D4701A probably damaging Het
Dyrk1a C A 16: 94,686,555 H541Q possibly damaging Het
Eml4 T C 17: 83,477,916 S906P probably benign Het
Fam129c T A 8: 71,607,515 I93N unknown Het
Fam169a G T 13: 97,107,070 V203F probably damaging Het
Fam69a A T 5: 107,909,910 F261I probably damaging Het
Fmn1 C T 2: 113,429,807 L682F unknown Het
Gli2 T C 1: 118,842,157 Y555C probably damaging Het
Gm3278 A G 14: 4,894,467 Y130C possibly damaging Het
Gm8237 T A 14: 5,863,554 Y37F probably damaging Het
Golga4 T G 9: 118,555,961 L717R probably damaging Het
Gtpbp4 C T 13: 8,974,213 R568H probably benign Het
Il1f10 A G 2: 24,293,185 N47S probably damaging Het
Itga6 A G 2: 71,843,274 H884R probably benign Het
Kdm1a T C 4: 136,559,207 K482R probably benign Het
Klk12 T C 7: 43,769,689 V26A probably benign Het
Lrp2 T A 2: 69,448,239 R3923S probably benign Het
Lrp2 C T 2: 69,458,423 V3700M probably benign Het
Lrrk2 A G 15: 91,752,197 D1458G probably benign Het
Mapre2 T A 18: 23,878,033 S233T probably benign Het
Mki67 T C 7: 135,695,208 D2699G possibly damaging Het
Mthfr T A 4: 148,044,490 Y214* probably null Het
Ncoa6 A T 2: 155,415,121 M834K possibly damaging Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Olfr1535 G A 13: 21,555,720 L101F probably damaging Het
Olfr344 T C 2: 36,568,903 Y102H possibly damaging Het
Olfr698 A T 7: 106,753,364 V8E probably benign Het
P2ry14 A G 3: 59,115,175 V288A possibly damaging Het
Pde6b G T 5: 108,428,239 S730I possibly damaging Het
Pdpk1 A T 17: 24,079,568 V496D probably damaging Het
Plekho2 A T 9: 65,556,272 L432M probably damaging Het
Ppa2 T C 3: 133,376,601 L151P unknown Het
Ppp2r3c G A 12: 55,281,714 T422I probably benign Het
Prelid3a T C 18: 67,477,052 S151P probably damaging Het
Rad21l G A 2: 151,645,453 P537L probably damaging Het
Sacs T A 14: 61,213,353 S4283T probably benign Het
Samd9l A T 6: 3,373,843 D1139E probably benign Het
Scn9a G T 2: 66,536,284 H718Q probably benign Het
Slc1a3 A T 15: 8,639,152 I443N probably damaging Het
Slc22a6 A G 19: 8,623,525 M361V probably benign Het
Slc8a2 A G 7: 16,157,207 Y724C probably damaging Het
Slf1 A T 13: 77,049,165 S777T possibly damaging Het
Sltm T C 9: 70,587,070 S901P probably benign Het
Smc1b A T 15: 85,112,846 H524Q probably benign Het
Spast T C 17: 74,359,346 S225P probably benign Het
Srsf12 C T 4: 33,231,246 R252W probably damaging Het
Syne1 A G 10: 5,229,229 L4415P probably damaging Het
Tmem117 A T 15: 94,638,109 Y8F probably benign Het
Tmem241 T C 18: 12,064,231 D180G possibly damaging Het
Tomm40 C T 7: 19,710,965 V164I probably benign Het
Twnk T C 19: 45,007,860 V244A probably benign Het
Ugt1a8 T C 1: 88,088,230 S122P probably damaging Het
Vmn1r78 A G 7: 12,152,612 K50R probably benign Het
Vmn2r10 A G 5: 109,003,524 F75L probably benign Het
Wbp4 G T 14: 79,470,133 Y179* probably null Het
Zfp106 A G 2: 120,524,119 probably null Het
Zfp974 A T 7: 27,910,936 C455S possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATTGCTTAACCATTGCATCCC -3'
(R):5'- TATGGGCCTTCACAGCTGAC -3'

Sequencing Primer
(F):5'- TTAACCATTGCATCCCTTCCACAAG -3'
(R):5'- GACCATCTCAAGTCCACAGCTTTG -3'
Posted On 2021-04-30