Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Col4a4'

668897

Institutional Source

Beutler Lab

Gene Symbol

Col4a4

Ensembl Gene

ENSMUSG00000067158

Gene Name

collagen, type IV, alpha 4

Synonyms

E130010M05Rik, [a]4(IV)

MMRRC Submission

Accession Numbers

Genbank: NM_007735; MGI: 104687

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82448423-82586849 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82455734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1496 (N1496I)

Ref Sequence

ENSEMBL: ENSMUSP00000084282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087050]

AlphaFold

Q9QZR9

Predicted Effect

unknown
Transcript: ENSMUST00000087050
AA Change: N1496I

SMART Domains

Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: N1496I

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
Pfam:Collagen	54	113	4e-11	PFAM
Pfam:Collagen	110	168	4.1e-10	PFAM
Pfam:Collagen	172	229	2.8e-10	PFAM
low complexity region	265	288	N/A	INTRINSIC
internal_repeat_7	289	345	1.46e-9	PROSPERO
internal_repeat_6	291	348	5.03e-10	PROSPERO
internal_repeat_9	297	353	7.22e-9	PROSPERO
internal_repeat_4	322	354	2.06e-11	PROSPERO
internal_repeat_11	334	349	1.25e-5	PROSPERO
Pfam:Collagen	392	449	1.3e-8	PFAM
low complexity region	461	482	N/A	INTRINSIC
Pfam:Collagen	486	553	1e-10	PFAM
low complexity region	563	595	N/A	INTRINSIC
Pfam:Collagen	597	658	1e-8	PFAM
Pfam:Collagen	663	731	4.4e-10	PFAM
Pfam:Collagen	755	810	3.3e-9	PFAM
internal_repeat_2	816	841	2.9e-13	PROSPERO
Pfam:Collagen	844	912	1.8e-10	PFAM
Pfam:Collagen	898	962	2.7e-10	PFAM
low complexity region	963	1003	N/A	INTRINSIC
Pfam:Collagen	1006	1071	2e-10	PFAM
Pfam:Collagen	1073	1132	5.8e-12	PFAM
Pfam:Collagen	1124	1185	1.8e-10	PFAM
Pfam:Collagen	1187	1245	2.3e-8	PFAM
low complexity region	1277	1361	N/A	INTRINSIC
low complexity region	1371	1384	N/A	INTRINSIC
Pfam:Collagen	1395	1454	4.3e-8	PFAM
C4	1457	1564	3.36e-58	SMART
C4	1565	1681	1.49e-59	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Col4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col4a4	APN	1	82491641	missense	unknown
IGL01092:Col4a4	APN	1	82466545	missense	unknown
IGL01104:Col4a4	APN	1	82466545	missense	unknown
IGL01413:Col4a4	APN	1	82471248	missense	unknown
IGL01518:Col4a4	APN	1	82455759	missense	unknown
IGL02014:Col4a4	APN	1	82523960	splice site	probably benign
IGL02215:Col4a4	APN	1	82453809	missense	unknown
IGL02707:Col4a4	APN	1	82493516	missense	unknown
IGL02858:Col4a4	APN	1	82528483	missense	unknown
IGL02987:Col4a4	APN	1	82498925	splice site	probably benign
IGL03384:Col4a4	APN	1	82484438	missense	probably benign	0.04
amazement	UTSW	1	82480486	nonsense	probably null
aoba	UTSW	1	82535740	critical splice donor site	probably benign
asombro	UTSW	1	82489009	critical splice donor site	probably null
astonishment	UTSW	1	82455728	missense	unknown
wonderment	UTSW	1	82453144	missense	unknown
IGL02980:Col4a4	UTSW	1	82469477	critical splice donor site	probably null
R0028:Col4a4	UTSW	1	82487510	critical splice donor site	probably null
R0083:Col4a4	UTSW	1	82507111	critical splice acceptor site	probably null
R0696:Col4a4	UTSW	1	82492549	missense	unknown
R0788:Col4a4	UTSW	1	82524996	missense	unknown
R0789:Col4a4	UTSW	1	82524996	missense	unknown
R0790:Col4a4	UTSW	1	82524996	missense	unknown
R0894:Col4a4	UTSW	1	82529656	splice site	probably null
R1217:Col4a4	UTSW	1	82489009	critical splice donor site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1474:Col4a4	UTSW	1	82480486	nonsense	probably null
R1508:Col4a4	UTSW	1	82455836	missense	unknown
R1640:Col4a4	UTSW	1	82535770	missense	unknown
R1678:Col4a4	UTSW	1	82486659	missense	unknown
R1827:Col4a4	UTSW	1	82539988	missense	unknown
R1930:Col4a4	UTSW	1	82466600	splice site	probably null
R1931:Col4a4	UTSW	1	82466600	splice site	probably null
R2092:Col4a4	UTSW	1	82498946	missense	unknown
R2122:Col4a4	UTSW	1	82456871	missense	unknown
R2132:Col4a4	UTSW	1	82497860	missense	unknown
R2396:Col4a4	UTSW	1	82507072	missense	unknown
R2418:Col4a4	UTSW	1	82532936	missense	unknown
R2679:Col4a4	UTSW	1	82529611	missense	unknown
R3085:Col4a4	UTSW	1	82529564	critical splice donor site	probably null
R3437:Col4a4	UTSW	1	82497168	missense	unknown
R3697:Col4a4	UTSW	1	82541237	missense	unknown
R3730:Col4a4	UTSW	1	82455751	splice site	probably null
R3752:Col4a4	UTSW	1	82480494	missense	probably damaging	0.97
R4085:Col4a4	UTSW	1	82471188	critical splice donor site	probably null
R4087:Col4a4	UTSW	1	82523922	missense	unknown
R4088:Col4a4	UTSW	1	82523922	missense	unknown
R4090:Col4a4	UTSW	1	82523922	missense	unknown
R4213:Col4a4	UTSW	1	82453144	missense	unknown
R4422:Col4a4	UTSW	1	82489838	missense	unknown
R4596:Col4a4	UTSW	1	82471219	missense	unknown
R4755:Col4a4	UTSW	1	82541174	missense	unknown
R4757:Col4a4	UTSW	1	82528466	missense	unknown
R4793:Col4a4	UTSW	1	82539099	missense	unknown
R4812:Col4a4	UTSW	1	82462153	missense	unknown
R4833:Col4a4	UTSW	1	82529602	missense	unknown
R5259:Col4a4	UTSW	1	82453893	missense	unknown
R5264:Col4a4	UTSW	1	82493591	missense	unknown
R5265:Col4a4	UTSW	1	82493591	missense	unknown
R5281:Col4a4	UTSW	1	82493591	missense	unknown
R5283:Col4a4	UTSW	1	82493591	missense	unknown
R5284:Col4a4	UTSW	1	82493591	missense	unknown
R5387:Col4a4	UTSW	1	82493591	missense	unknown
R5388:Col4a4	UTSW	1	82493591	missense	unknown
R5435:Col4a4	UTSW	1	82454007	missense	unknown
R5534:Col4a4	UTSW	1	82487517	missense	unknown
R5666:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5670:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5943:Col4a4	UTSW	1	82525016	missense	unknown
R5996:Col4a4	UTSW	1	82455728	missense	unknown
R5999:Col4a4	UTSW	1	82492619	missense	unknown
R6112:Col4a4	UTSW	1	82453883	missense	unknown
R6192:Col4a4	UTSW	1	82484430	missense	probably damaging	1.00
R6237:Col4a4	UTSW	1	82507031	missense	unknown
R6419:Col4a4	UTSW	1	82466486	critical splice donor site	probably null
R6458:Col4a4	UTSW	1	82455825	missense	unknown
R6460:Col4a4	UTSW	1	82466532	missense	unknown
R6481:Col4a4	UTSW	1	82453778	missense	unknown
R6522:Col4a4	UTSW	1	82487583	missense	unknown
R7000:Col4a4	UTSW	1	82497330	missense	unknown
R7015:Col4a4	UTSW	1	82506950	missense	unknown
R7055:Col4a4	UTSW	1	82519036	missense	unknown
R7288:Col4a4	UTSW	1	82492463	missense	unknown
R7293:Col4a4	UTSW	1	82523943	missense	unknown
R7300:Col4a4	UTSW	1	82486640	missense	unknown
R7458:Col4a4	UTSW	1	82498948	missense	unknown
R7520:Col4a4	UTSW	1	82507087	nonsense	probably null
R7727:Col4a4	UTSW	1	82528793	missense	unknown
R7803:Col4a4	UTSW	1	82489698	critical splice donor site	probably null
R7953:Col4a4	UTSW	1	82453968	missense	unknown
R7959:Col4a4	UTSW	1	82507059	missense	unknown
R7982:Col4a4	UTSW	1	82571441	start gained	probably benign
R8000:Col4a4	UTSW	1	82541297	missense	unknown
R8057:Col4a4	UTSW	1	82523870	missense	unknown
R8126:Col4a4	UTSW	1	82453286	missense	unknown
R8406:Col4a4	UTSW	1	82523890	missense	unknown
R8835:Col4a4	UTSW	1	82469592	missense	unknown
R8916:Col4a4	UTSW	1	82523946	missense	unknown
R8921:Col4a4	UTSW	1	82453812	missense	unknown
R8990:Col4a4	UTSW	1	82495834	missense	unknown
R9002:Col4a4	UTSW	1	82471311	missense	probably benign	0.26
R9116:Col4a4	UTSW	1	82454031	missense	unknown
R9176:Col4a4	UTSW	1	82485628	missense	unknown
R9211:Col4a4	UTSW	1	82528780	missense	unknown
R9246:Col4a4	UTSW	1	82453235	missense	unknown
R9463:Col4a4	UTSW	1	82453355	missense	unknown
R9666:Col4a4	UTSW	1	82518949	missense	unknown
R9686:Col4a4	UTSW	1	82497241	missense	unknown
R9705:Col4a4	UTSW	1	82487592	missense	unknown
R9749:Col4a4	UTSW	1	82485632	missense	unknown
R9774:Col4a4	UTSW	1	82506944	critical splice donor site	probably null
X0020:Col4a4	UTSW	1	82539952	critical splice donor site	probably null
Z1088:Col4a4	UTSW	1	82453196	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCAGAATGAGCCTCTGTGG -3'
(R):5'- TGGTCCAACTGGTGATCCTG -3'

Sequencing Primer
(F):5'- CTCTGTGGCATATAACAGGGTC -3'
(R):5'- TGGTGATCCTGGGCCCAAG -3'

Posted On

2021-04-30