Incidental Mutation 'R8699:Col4a4'
ID 668897
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Name collagen, type IV, alpha 4
Synonyms E130010M05Rik, [a]4(IV)
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 82426144-82564570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82433455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1496 (N1496I)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
AlphaFold Q9QZR9
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: N1496I
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: N1496I

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82,469,362 (GRCm39) missense unknown
IGL01092:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01104:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01413:Col4a4 APN 1 82,448,969 (GRCm39) missense unknown
IGL01518:Col4a4 APN 1 82,433,480 (GRCm39) missense unknown
IGL02014:Col4a4 APN 1 82,501,681 (GRCm39) splice site probably benign
IGL02215:Col4a4 APN 1 82,431,530 (GRCm39) missense unknown
IGL02707:Col4a4 APN 1 82,471,237 (GRCm39) missense unknown
IGL02858:Col4a4 APN 1 82,506,204 (GRCm39) missense unknown
IGL02987:Col4a4 APN 1 82,476,646 (GRCm39) splice site probably benign
IGL03384:Col4a4 APN 1 82,462,159 (GRCm39) missense probably benign 0.04
amazement UTSW 1 82,458,207 (GRCm39) nonsense probably null
aoba UTSW 1 82,513,461 (GRCm39) critical splice donor site probably benign
asombro UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
astonishment UTSW 1 82,433,449 (GRCm39) missense unknown
wonderment UTSW 1 82,430,865 (GRCm39) missense unknown
IGL02980:Col4a4 UTSW 1 82,447,198 (GRCm39) critical splice donor site probably null
R0028:Col4a4 UTSW 1 82,465,231 (GRCm39) critical splice donor site probably null
R0083:Col4a4 UTSW 1 82,484,832 (GRCm39) critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82,470,270 (GRCm39) missense unknown
R0788:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0789:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0790:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0894:Col4a4 UTSW 1 82,507,377 (GRCm39) splice site probably null
R1217:Col4a4 UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1474:Col4a4 UTSW 1 82,458,207 (GRCm39) nonsense probably null
R1508:Col4a4 UTSW 1 82,433,557 (GRCm39) missense unknown
R1640:Col4a4 UTSW 1 82,513,491 (GRCm39) missense unknown
R1678:Col4a4 UTSW 1 82,464,380 (GRCm39) missense unknown
R1827:Col4a4 UTSW 1 82,517,709 (GRCm39) missense unknown
R1930:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R1931:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R2092:Col4a4 UTSW 1 82,476,667 (GRCm39) missense unknown
R2122:Col4a4 UTSW 1 82,434,592 (GRCm39) missense unknown
R2132:Col4a4 UTSW 1 82,475,581 (GRCm39) missense unknown
R2396:Col4a4 UTSW 1 82,484,793 (GRCm39) missense unknown
R2418:Col4a4 UTSW 1 82,510,657 (GRCm39) missense unknown
R2679:Col4a4 UTSW 1 82,507,332 (GRCm39) missense unknown
R3085:Col4a4 UTSW 1 82,507,285 (GRCm39) critical splice donor site probably null
R3437:Col4a4 UTSW 1 82,474,889 (GRCm39) missense unknown
R3697:Col4a4 UTSW 1 82,518,958 (GRCm39) missense unknown
R3730:Col4a4 UTSW 1 82,433,472 (GRCm39) splice site probably null
R3752:Col4a4 UTSW 1 82,458,215 (GRCm39) missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82,448,909 (GRCm39) critical splice donor site probably null
R4087:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4088:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4090:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4213:Col4a4 UTSW 1 82,430,865 (GRCm39) missense unknown
R4422:Col4a4 UTSW 1 82,467,559 (GRCm39) missense unknown
R4596:Col4a4 UTSW 1 82,448,940 (GRCm39) missense unknown
R4755:Col4a4 UTSW 1 82,518,895 (GRCm39) missense unknown
R4757:Col4a4 UTSW 1 82,506,187 (GRCm39) missense unknown
R4793:Col4a4 UTSW 1 82,516,820 (GRCm39) missense unknown
R4812:Col4a4 UTSW 1 82,439,874 (GRCm39) missense unknown
R4833:Col4a4 UTSW 1 82,507,323 (GRCm39) missense unknown
R5259:Col4a4 UTSW 1 82,431,614 (GRCm39) missense unknown
R5264:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5265:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5281:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5283:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5284:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5387:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5388:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5435:Col4a4 UTSW 1 82,431,728 (GRCm39) missense unknown
R5534:Col4a4 UTSW 1 82,465,238 (GRCm39) missense unknown
R5666:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5670:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5943:Col4a4 UTSW 1 82,502,737 (GRCm39) missense unknown
R5996:Col4a4 UTSW 1 82,433,449 (GRCm39) missense unknown
R5999:Col4a4 UTSW 1 82,470,340 (GRCm39) missense unknown
R6112:Col4a4 UTSW 1 82,431,604 (GRCm39) missense unknown
R6192:Col4a4 UTSW 1 82,462,151 (GRCm39) missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82,484,752 (GRCm39) missense unknown
R6419:Col4a4 UTSW 1 82,444,207 (GRCm39) critical splice donor site probably null
R6458:Col4a4 UTSW 1 82,433,546 (GRCm39) missense unknown
R6460:Col4a4 UTSW 1 82,444,253 (GRCm39) missense unknown
R6481:Col4a4 UTSW 1 82,431,499 (GRCm39) missense unknown
R6522:Col4a4 UTSW 1 82,465,304 (GRCm39) missense unknown
R7000:Col4a4 UTSW 1 82,475,051 (GRCm39) missense unknown
R7015:Col4a4 UTSW 1 82,484,671 (GRCm39) missense unknown
R7055:Col4a4 UTSW 1 82,496,757 (GRCm39) missense unknown
R7288:Col4a4 UTSW 1 82,470,184 (GRCm39) missense unknown
R7293:Col4a4 UTSW 1 82,501,664 (GRCm39) missense unknown
R7300:Col4a4 UTSW 1 82,464,361 (GRCm39) missense unknown
R7458:Col4a4 UTSW 1 82,476,669 (GRCm39) missense unknown
R7520:Col4a4 UTSW 1 82,484,808 (GRCm39) nonsense probably null
R7727:Col4a4 UTSW 1 82,506,514 (GRCm39) missense unknown
R7803:Col4a4 UTSW 1 82,467,419 (GRCm39) critical splice donor site probably null
R7953:Col4a4 UTSW 1 82,431,689 (GRCm39) missense unknown
R7959:Col4a4 UTSW 1 82,484,780 (GRCm39) missense unknown
R7982:Col4a4 UTSW 1 82,549,162 (GRCm39) start gained probably benign
R8000:Col4a4 UTSW 1 82,519,018 (GRCm39) missense unknown
R8057:Col4a4 UTSW 1 82,501,591 (GRCm39) missense unknown
R8126:Col4a4 UTSW 1 82,431,007 (GRCm39) missense unknown
R8406:Col4a4 UTSW 1 82,501,611 (GRCm39) missense unknown
R8835:Col4a4 UTSW 1 82,447,313 (GRCm39) missense unknown
R8916:Col4a4 UTSW 1 82,501,667 (GRCm39) missense unknown
R8921:Col4a4 UTSW 1 82,431,533 (GRCm39) missense unknown
R8990:Col4a4 UTSW 1 82,473,555 (GRCm39) missense unknown
R9002:Col4a4 UTSW 1 82,449,032 (GRCm39) missense probably benign 0.26
R9116:Col4a4 UTSW 1 82,431,752 (GRCm39) missense unknown
R9176:Col4a4 UTSW 1 82,463,349 (GRCm39) missense unknown
R9211:Col4a4 UTSW 1 82,506,501 (GRCm39) missense unknown
R9246:Col4a4 UTSW 1 82,430,956 (GRCm39) missense unknown
R9463:Col4a4 UTSW 1 82,431,076 (GRCm39) missense unknown
R9666:Col4a4 UTSW 1 82,496,670 (GRCm39) missense unknown
R9686:Col4a4 UTSW 1 82,474,962 (GRCm39) missense unknown
R9705:Col4a4 UTSW 1 82,465,313 (GRCm39) missense unknown
R9749:Col4a4 UTSW 1 82,463,353 (GRCm39) missense unknown
R9774:Col4a4 UTSW 1 82,484,665 (GRCm39) critical splice donor site probably null
X0020:Col4a4 UTSW 1 82,517,673 (GRCm39) critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82,430,917 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCAGAATGAGCCTCTGTGG -3'
(R):5'- TGGTCCAACTGGTGATCCTG -3'

Sequencing Primer
(F):5'- CTCTGTGGCATATAACAGGGTC -3'
(R):5'- TGGTGATCCTGGGCCCAAG -3'
Posted On 2021-04-30