Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Tpr'

668898

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150418021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 922 (I922N)

Ref Sequence

ENSEMBL: ENSMUSP00000117616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000119161
AA Change: I848N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: I848N

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000124973
AA Change: I922N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: I922N

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
R9618:Tpr	UTSW	1	150446228	missense	possibly damaging	0.70
R9680:Tpr	UTSW	1	150439136	missense	probably benign	0.32
R9776:Tpr	UTSW	1	150449188	missense	probably benign	0.00
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCATATGTCCAACAACAATCTTCTC -3'
(R):5'- CTGCTAGAGGGAGAATTGCTC -3'

Sequencing Primer
(F):5'- TGTCCAACAACAATCTTCTCAATTC -3'
(R):5'- TGGGATCACTAATTGGACTCAG -3'

Posted On

2021-04-30