Incidental Mutation 'R8699:Tpr'
ID 668898
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Name translocated promoter region, nuclear basket protein
Synonyms 2610029M07Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 150268589-150325686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150293772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 922 (I922N)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
AlphaFold F6ZDS4
Predicted Effect probably damaging
Transcript: ENSMUST00000119161
AA Change: I848N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: I848N

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124973
AA Change: I922N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: I922N

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150,299,447 (GRCm39) splice site probably benign
IGL00424:Tpr APN 1 150,274,346 (GRCm39) splice site probably benign
IGL01095:Tpr APN 1 150,285,891 (GRCm39) missense possibly damaging 0.95
IGL01347:Tpr APN 1 150,302,738 (GRCm39) missense probably damaging 1.00
IGL01519:Tpr APN 1 150,306,919 (GRCm39) missense probably benign 0.01
IGL01768:Tpr APN 1 150,320,199 (GRCm39) missense possibly damaging 0.85
IGL01939:Tpr APN 1 150,289,496 (GRCm39) missense possibly damaging 0.82
IGL01988:Tpr APN 1 150,302,750 (GRCm39) splice site probably null
IGL02065:Tpr APN 1 150,289,525 (GRCm39) missense probably benign 0.13
IGL02110:Tpr APN 1 150,311,493 (GRCm39) missense probably damaging 0.97
IGL02311:Tpr APN 1 150,274,404 (GRCm39) missense probably damaging 0.97
IGL02454:Tpr APN 1 150,306,943 (GRCm39) missense probably benign 0.00
IGL02569:Tpr APN 1 150,301,382 (GRCm39) unclassified probably benign
IGL03168:Tpr APN 1 150,284,508 (GRCm39) missense probably benign 0.04
IGL03193:Tpr APN 1 150,315,831 (GRCm39) missense possibly damaging 0.85
IGL03333:Tpr APN 1 150,302,718 (GRCm39) missense probably benign 0.04
gridiron UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
Pouch UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
punt UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
Turf UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
F6893:Tpr UTSW 1 150,269,313 (GRCm39) missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150,315,888 (GRCm39) missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150,279,707 (GRCm39) missense probably benign 0.41
R0085:Tpr UTSW 1 150,293,164 (GRCm39) missense possibly damaging 0.95
R0101:Tpr UTSW 1 150,285,053 (GRCm39) splice site probably benign
R0116:Tpr UTSW 1 150,285,898 (GRCm39) missense probably damaging 0.98
R0136:Tpr UTSW 1 150,306,346 (GRCm39) missense probably benign 0.01
R0207:Tpr UTSW 1 150,293,178 (GRCm39) missense possibly damaging 0.74
R0219:Tpr UTSW 1 150,319,009 (GRCm39) splice site probably null
R0380:Tpr UTSW 1 150,288,698 (GRCm39) missense probably benign 0.27
R0403:Tpr UTSW 1 150,283,165 (GRCm39) splice site probably benign
R0469:Tpr UTSW 1 150,299,418 (GRCm39) frame shift probably null
R0480:Tpr UTSW 1 150,303,992 (GRCm39) missense possibly damaging 0.83
R0514:Tpr UTSW 1 150,278,024 (GRCm39) missense possibly damaging 0.55
R0563:Tpr UTSW 1 150,284,609 (GRCm39) missense probably benign 0.13
R0631:Tpr UTSW 1 150,298,282 (GRCm39) missense probably damaging 0.98
R0685:Tpr UTSW 1 150,309,476 (GRCm39) missense possibly damaging 0.69
R0730:Tpr UTSW 1 150,269,158 (GRCm39) utr 5 prime probably benign
R0739:Tpr UTSW 1 150,283,248 (GRCm39) missense possibly damaging 0.94
R0780:Tpr UTSW 1 150,307,092 (GRCm39) missense probably benign 0.00
R1018:Tpr UTSW 1 150,317,934 (GRCm39) missense possibly damaging 0.53
R1084:Tpr UTSW 1 150,317,912 (GRCm39) missense probably benign 0.18
R1532:Tpr UTSW 1 150,293,751 (GRCm39) missense probably damaging 0.99
R1551:Tpr UTSW 1 150,312,552 (GRCm39) missense probably benign 0.00
R1608:Tpr UTSW 1 150,302,644 (GRCm39) missense probably damaging 0.96
R1759:Tpr UTSW 1 150,305,275 (GRCm39) missense probably benign 0.19
R1817:Tpr UTSW 1 150,295,654 (GRCm39) missense probably damaging 0.98
R1932:Tpr UTSW 1 150,297,414 (GRCm39) missense probably benign 0.00
R1978:Tpr UTSW 1 150,295,658 (GRCm39) missense possibly damaging 0.65
R2031:Tpr UTSW 1 150,317,870 (GRCm39) missense probably benign
R2176:Tpr UTSW 1 150,295,691 (GRCm39) missense possibly damaging 0.56
R2235:Tpr UTSW 1 150,317,843 (GRCm39) missense probably benign 0.33
R2339:Tpr UTSW 1 150,289,525 (GRCm39) missense probably benign 0.01
R2367:Tpr UTSW 1 150,309,479 (GRCm39) missense probably damaging 0.99
R2507:Tpr UTSW 1 150,268,695 (GRCm39) start codon destroyed probably null
R3931:Tpr UTSW 1 150,311,655 (GRCm39) missense probably damaging 1.00
R4320:Tpr UTSW 1 150,299,325 (GRCm39) missense possibly damaging 0.96
R4439:Tpr UTSW 1 150,279,712 (GRCm39) missense probably benign 0.01
R4568:Tpr UTSW 1 150,268,710 (GRCm39) unclassified probably benign
R4644:Tpr UTSW 1 150,299,250 (GRCm39) missense probably benign 0.01
R4665:Tpr UTSW 1 150,320,150 (GRCm39) missense probably damaging 0.97
R4672:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4673:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4735:Tpr UTSW 1 150,317,947 (GRCm39) missense possibly damaging 0.91
R4767:Tpr UTSW 1 150,306,280 (GRCm39) intron probably benign
R4772:Tpr UTSW 1 150,288,864 (GRCm39) missense possibly damaging 0.46
R4815:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign 0.01
R4839:Tpr UTSW 1 150,324,948 (GRCm39) nonsense probably null
R4844:Tpr UTSW 1 150,321,630 (GRCm39) missense possibly damaging 0.86
R4925:Tpr UTSW 1 150,308,316 (GRCm39) missense probably benign 0.00
R4967:Tpr UTSW 1 150,285,810 (GRCm39) missense probably damaging 0.99
R5017:Tpr UTSW 1 150,274,388 (GRCm39) missense probably benign 0.00
R5096:Tpr UTSW 1 150,321,953 (GRCm39) missense probably damaging 0.99
R5353:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5354:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5484:Tpr UTSW 1 150,302,639 (GRCm39) missense probably benign 0.33
R5601:Tpr UTSW 1 150,311,604 (GRCm39) missense possibly damaging 0.75
R5642:Tpr UTSW 1 150,299,569 (GRCm39) missense probably damaging 0.99
R5779:Tpr UTSW 1 150,299,292 (GRCm39) missense probably damaging 1.00
R5787:Tpr UTSW 1 150,271,037 (GRCm39) missense probably benign 0.01
R5892:Tpr UTSW 1 150,283,151 (GRCm39) missense probably benign 0.44
R5915:Tpr UTSW 1 150,301,400 (GRCm39) missense probably benign 0.15
R5928:Tpr UTSW 1 150,303,878 (GRCm39) missense probably benign 0.30
R6146:Tpr UTSW 1 150,298,913 (GRCm39) missense possibly damaging 0.83
R6154:Tpr UTSW 1 150,299,567 (GRCm39) missense probably benign 0.00
R6234:Tpr UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
R6263:Tpr UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
R6318:Tpr UTSW 1 150,321,639 (GRCm39) missense possibly damaging 0.93
R6550:Tpr UTSW 1 150,299,728 (GRCm39) missense probably damaging 1.00
R6592:Tpr UTSW 1 150,287,656 (GRCm39) missense possibly damaging 0.83
R6704:Tpr UTSW 1 150,282,259 (GRCm39) missense possibly damaging 0.80
R6716:Tpr UTSW 1 150,290,516 (GRCm39) missense probably damaging 1.00
R6836:Tpr UTSW 1 150,312,424 (GRCm39) splice site probably null
R6886:Tpr UTSW 1 150,299,716 (GRCm39) missense probably benign 0.00
R6894:Tpr UTSW 1 150,312,598 (GRCm39) missense probably benign 0.28
R6928:Tpr UTSW 1 150,284,536 (GRCm39) missense possibly damaging 0.83
R7011:Tpr UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
R7034:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7036:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7183:Tpr UTSW 1 150,282,302 (GRCm39) missense probably damaging 1.00
R7221:Tpr UTSW 1 150,321,929 (GRCm39) missense possibly damaging 0.96
R7223:Tpr UTSW 1 150,315,007 (GRCm39) missense possibly damaging 0.53
R7294:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R7343:Tpr UTSW 1 150,269,245 (GRCm39) missense unknown
R7361:Tpr UTSW 1 150,323,372 (GRCm39) missense possibly damaging 0.73
R7405:Tpr UTSW 1 150,317,878 (GRCm39) missense probably benign 0.02
R7637:Tpr UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
R7720:Tpr UTSW 1 150,305,283 (GRCm39) missense possibly damaging 0.49
R7721:Tpr UTSW 1 150,320,180 (GRCm39) missense probably benign
R7751:Tpr UTSW 1 150,295,646 (GRCm39) missense probably benign 0.17
R7804:Tpr UTSW 1 150,308,310 (GRCm39) missense probably damaging 0.99
R7878:Tpr UTSW 1 150,299,411 (GRCm39) missense possibly damaging 0.67
R7973:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R8013:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign
R8220:Tpr UTSW 1 150,308,164 (GRCm39) missense probably benign 0.05
R8274:Tpr UTSW 1 150,299,230 (GRCm39) splice site probably benign
R8428:Tpr UTSW 1 150,290,564 (GRCm39) missense probably damaging 1.00
R8482:Tpr UTSW 1 150,309,451 (GRCm39) missense probably damaging 1.00
R8859:Tpr UTSW 1 150,284,597 (GRCm39) missense possibly damaging 0.90
R9119:Tpr UTSW 1 150,279,753 (GRCm39) missense probably damaging 0.99
R9326:Tpr UTSW 1 150,301,407 (GRCm39) missense possibly damaging 0.86
R9618:Tpr UTSW 1 150,321,979 (GRCm39) missense possibly damaging 0.70
R9680:Tpr UTSW 1 150,314,887 (GRCm39) missense probably benign 0.32
R9776:Tpr UTSW 1 150,324,939 (GRCm39) missense probably benign 0.00
X0021:Tpr UTSW 1 150,270,958 (GRCm39) missense probably damaging 1.00
Z1177:Tpr UTSW 1 150,303,986 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATATGTCCAACAACAATCTTCTC -3'
(R):5'- CTGCTAGAGGGAGAATTGCTC -3'

Sequencing Primer
(F):5'- TGTCCAACAACAATCTTCTCAATTC -3'
(R):5'- TGGGATCACTAATTGGACTCAG -3'
Posted On 2021-04-30