Incidental Mutation 'R8699:Olfr1002'
ID 668905
Institutional Source Beutler Lab
Gene Symbol Olfr1002
Ensembl Gene ENSMUSG00000075214
Gene Name olfactory receptor 1002
Synonyms GA_x6K02T2Q125-47127746-47126790, MOR175-2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85646057-85650704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85647986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 112 (C112S)
Ref Sequence ENSEMBL: ENSMUSP00000150405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099920] [ENSMUST00000215548]
AlphaFold Q8VFK2
Predicted Effect possibly damaging
Transcript: ENSMUST00000099920
AA Change: C112S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097504
Gene: ENSMUSG00000075214
AA Change: C112S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-50 PFAM
Pfam:7tm_1 41 290 2.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215548
AA Change: C112S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Olfr1002
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Olfr1002 APN 2 85648143 missense probably damaging 0.98
IGL02873:Olfr1002 APN 2 85647752 missense possibly damaging 0.50
PIT4362001:Olfr1002 UTSW 2 85647724 missense probably damaging 1.00
R1241:Olfr1002 UTSW 2 85647560 missense probably damaging 1.00
R1261:Olfr1002 UTSW 2 85647799 missense probably damaging 1.00
R1666:Olfr1002 UTSW 2 85647813 nonsense probably null
R1902:Olfr1002 UTSW 2 85647857 missense possibly damaging 0.81
R1965:Olfr1002 UTSW 2 85647746 missense possibly damaging 0.94
R2096:Olfr1002 UTSW 2 85648090 missense probably benign 0.20
R4239:Olfr1002 UTSW 2 85648303 missense probably damaging 0.98
R4730:Olfr1002 UTSW 2 85647992 missense probably benign 0.39
R4948:Olfr1002 UTSW 2 85647572 missense probably benign 0.30
R5627:Olfr1002 UTSW 2 85647647 missense probably damaging 1.00
R5844:Olfr1002 UTSW 2 85647895 missense probably benign 0.36
R6809:Olfr1002 UTSW 2 85647973 missense probably damaging 1.00
R7399:Olfr1002 UTSW 2 85647424 missense possibly damaging 0.89
R7476:Olfr1002 UTSW 2 85648168 missense not run
R7805:Olfr1002 UTSW 2 85647450 nonsense probably null
R7960:Olfr1002 UTSW 2 85648073 missense possibly damaging 0.82
R8015:Olfr1002 UTSW 2 85647792 missense probably damaging 0.99
R8355:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8455:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8479:Olfr1002 UTSW 2 85648103 missense probably damaging 1.00
R8683:Olfr1002 UTSW 2 85648066 missense probably benign 0.35
R8762:Olfr1002 UTSW 2 85647690 missense probably damaging 1.00
R8897:Olfr1002 UTSW 2 85647843 missense possibly damaging 0.92
R9280:Olfr1002 UTSW 2 85648160 nonsense probably null
R9674:Olfr1002 UTSW 2 85648249 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGATGAGATTTGGACCACAGTATG -3'
(R):5'- ATCTCGCAACTCTTCTGGGG -3'

Sequencing Primer
(F):5'- ACAGTATGGAAGAATAAATGCAGAAG -3'
(R):5'- GGGAATGATCATTCTTATTCACCAGG -3'
Posted On 2021-04-30