Incidental Mutation 'R8699:Ncaph'
ID668908
Institutional Source Beutler Lab
Gene Symbol Ncaph
Ensembl Gene ENSMUSG00000034906
Gene Namenon-SMC condensin I complex, subunit H
SynonymsA730011O11Rik, HCAP-H, Brrn1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127103809-127133954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127121176 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 379 (D379G)
Ref Sequence ENSEMBL: ENSMUSP00000106017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110387]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110387
AA Change: D379G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106017
Gene: ENSMUSG00000034906
AA Change: D379G

DomainStartEndE-ValueType
Pfam:Cnd2 25 729 9e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175885
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the barr gene family and a regulatory subunit of the condensin complex. This complex is required for the conversion of interphase chromatin into condensed chromosomes. The protein encoded by this gene is associated with mitotic chromosomes, except during the early phase of chromosome condensation. During interphase, the protein has a distinct punctate nucleolar localization. Alternatively spliced transcript variants encoding different proteins have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Ncaph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Ncaph APN 2 127126105 splice site probably benign
IGL02619:Ncaph APN 2 127127536 missense probably damaging 0.99
IGL02674:Ncaph APN 2 127113576 missense probably damaging 0.98
IGL02679:Ncaph APN 2 127124864 missense possibly damaging 0.95
R2060:Ncaph UTSW 2 127124875 missense probably damaging 1.00
R3508:Ncaph UTSW 2 127127193 missense probably benign 0.33
R4283:Ncaph UTSW 2 127121085 intron probably benign
R4761:Ncaph UTSW 2 127106116 missense probably benign 0.07
R4957:Ncaph UTSW 2 127121257 missense possibly damaging 0.46
R5491:Ncaph UTSW 2 127123675 missense probably benign
R5942:Ncaph UTSW 2 127116688 splice site probably null
R6523:Ncaph UTSW 2 127105889 missense probably damaging 0.97
R7177:Ncaph UTSW 2 127116586 missense probably damaging 1.00
R7188:Ncaph UTSW 2 127122114 missense probably benign 0.09
R7467:Ncaph UTSW 2 127133875 unclassified probably benign
R7857:Ncaph UTSW 2 127104245 missense probably damaging 0.99
R8701:Ncaph UTSW 2 127106138 missense probably benign 0.13
R8843:Ncaph UTSW 2 127108609 missense probably benign
X0021:Ncaph UTSW 2 127127138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGACCAACATCAGTTC -3'
(R):5'- CTGGAGAGCTGTGTCTTCTC -3'

Sequencing Primer
(F):5'- CAGTTCTATAATGAAGTGGGTCACC -3'
(R):5'- AGAGCTGTGTCTTCTCCTTGTAGTC -3'
Posted On2021-04-30