Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Ptprd'

668916

Institutional Source

Beutler Lab

Gene Symbol

Ptprd

Ensembl Gene

ENSMUSG00000028399

Gene Name

protein tyrosine phosphatase, receptor type, D

Synonyms

1110002J03Rik, 3000002J10Rik, B230219D21Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75941238-78211961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76041392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 279 (F279I)

Ref Sequence

ENSEMBL: ENSMUSP00000148560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]

AlphaFold

Q64487

Predicted Effect

probably benign
Transcript: ENSMUST00000050757

SMART Domains

Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
IGc2	238	299	8.13e-4	SMART
FN3	313	392	7.92e-14	SMART
FN3	408	491	5.73e-11	SMART
IG_like	499	593	8.34e1	SMART
FN3	506	584	9.1e-14	SMART
FN3	597	674	1.21e0	SMART
transmembrane domain	847	869	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098005

SMART Domains

Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	886	897	N/A	INTRINSIC
PTPc	950	1208	6.38e-134	SMART
PTPc	1237	1499	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102834

SMART Domains

Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	1	62	8.13e-4	SMART
FN3	76	155	7.92e-14	SMART
FN3	171	254	5.73e-11	SMART
IG_like	262	356	8.34e1	SMART
FN3	269	347	9.1e-14	SMART
FN3	360	437	1.21e0	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	633	645	N/A	INTRINSIC
PTPc	698	956	6.38e-134	SMART
PTPc	985	1247	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107289

SMART Domains

Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	609	696	2.72e-12	SMART
FN3	712	809	2.87e-11	SMART
FN3	824	904	4.96e-6	SMART
FN3	919	1003	4.12e-12	SMART
FN3	1018	1095	1.95e0	SMART
transmembrane domain	1268	1290	N/A	INTRINSIC
low complexity region	1291	1303	N/A	INTRINSIC
PTPc	1356	1614	6.38e-134	SMART
PTPc	1643	1905	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173376

SMART Domains

Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	43	112	8.57e-12	SMART
IGc2	145	221	8.5e-16	SMART
low complexity region	232	244	N/A	INTRINSIC
IGc2	255	316	8.13e-4	SMART
FN3	330	409	7.92e-14	SMART
FN3	425	508	5.73e-11	SMART
IG_like	516	610	8.34e1	SMART
FN3	523	601	9.1e-14	SMART
FN3	614	691	1.21e0	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	887	899	N/A	INTRINSIC
PTPc	952	1210	6.38e-134	SMART
PTPc	1239	1501	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174023

SMART Domains

Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	211	4.88e-16	SMART
low complexity region	222	234	N/A	INTRINSIC
IGc2	245	306	8.13e-4	SMART
FN3	320	399	7.92e-14	SMART
FN3	415	498	5.73e-11	SMART
IG_like	506	600	8.34e1	SMART
FN3	513	591	9.1e-14	SMART
FN3	604	681	1.21e0	SMART
transmembrane domain	853	875	N/A	INTRINSIC
low complexity region	882	893	N/A	INTRINSIC
PTPc	946	1204	6.38e-134	SMART
PTPc	1233	1495	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174180

SMART Domains

Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	205	2.09e-15	SMART
IGc2	235	296	8.13e-4	SMART
FN3	310	389	7.92e-14	SMART
FN3	405	488	5.73e-11	SMART
IG_like	496	590	8.34e1	SMART
FN3	503	581	9.1e-14	SMART
FN3	596	683	2.72e-12	SMART
FN3	699	787	6.15e-11	SMART
FN3	802	882	4.96e-6	SMART
FN3	897	981	4.12e-12	SMART
FN3	996	1073	1.95e0	SMART
transmembrane domain	1246	1268	N/A	INTRINSIC
low complexity region	1269	1281	N/A	INTRINSIC
PTPc	1334	1592	6.38e-134	SMART
PTPc	1621	1883	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174531

SMART Domains

Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
low complexity region	219	231	N/A	INTRINSIC
IGc2	242	303	8.13e-4	SMART
FN3	317	396	7.92e-14	SMART
FN3	412	495	5.73e-11	SMART
IG_like	503	597	8.34e1	SMART
FN3	510	588	9.1e-14	SMART
FN3	601	678	1.21e0	SMART
transmembrane domain	851	873	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
PTPc	939	1197	6.38e-134	SMART
PTPc	1226	1488	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174831

SMART Domains

Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212365
AA Change: F279I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Ptprd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Ptprd	APN	4	75998556	nonsense	probably null
IGL01067:Ptprd	APN	4	76059685	missense	probably damaging	1.00
IGL01121:Ptprd	APN	4	75954201	splice site	probably benign
IGL01531:Ptprd	APN	4	76085520	missense	probably damaging	0.98
IGL01661:Ptprd	APN	4	75954083	missense	probably damaging	1.00
IGL01723:Ptprd	APN	4	76243673	missense	probably damaging	1.00
IGL01735:Ptprd	APN	4	76136820	splice site	probably null
IGL01810:Ptprd	APN	4	76140507	splice site	probably benign
IGL01834:Ptprd	APN	4	76128595	missense	probably damaging	1.00
IGL01835:Ptprd	APN	4	76246821	missense	probably benign	0.02
IGL01867:Ptprd	APN	4	76243647	missense	probably damaging	1.00
IGL02582:Ptprd	APN	4	75947124	missense	probably damaging	1.00
IGL02591:Ptprd	APN	4	75982050	missense	probably damaging	1.00
IGL02741:Ptprd	APN	4	76133284	missense	probably damaging	1.00
IGL02866:Ptprd	APN	4	76050437	missense	probably damaging	1.00
IGL02960:Ptprd	APN	4	76128868	missense	probably damaging	1.00
IGL03155:Ptprd	APN	4	76066219	missense	possibly damaging	0.95
IGL03230:Ptprd	APN	4	76050417	nonsense	probably null
IGL03343:Ptprd	APN	4	76059729	missense	probably damaging	1.00
unhurried	UTSW	4	76100633	nonsense	probably null
ANU22:Ptprd	UTSW	4	76100456	missense	probably damaging	0.99
F5493:Ptprd	UTSW	4	76084408	missense	probably damaging	1.00
P0033:Ptprd	UTSW	4	76128854	nonsense	probably null
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0076:Ptprd	UTSW	4	75947039	splice site	probably benign
R0137:Ptprd	UTSW	4	76136903	missense	probably benign	0.24
R0358:Ptprd	UTSW	4	75944989	missense	probably damaging	1.00
R0365:Ptprd	UTSW	4	76136846	missense	probably damaging	1.00
R0385:Ptprd	UTSW	4	76128665	missense	probably damaging	1.00
R0601:Ptprd	UTSW	4	76100474	missense	probably benign
R0646:Ptprd	UTSW	4	76084403	missense	probably damaging	0.99
R0667:Ptprd	UTSW	4	75957346	missense	probably damaging	1.00
R0707:Ptprd	UTSW	4	75957239	missense	probably damaging	1.00
R0734:Ptprd	UTSW	4	76140597	missense	probably damaging	1.00
R0827:Ptprd	UTSW	4	76128915	missense	probably damaging	0.98
R0932:Ptprd	UTSW	4	76136885	missense	probably damaging	1.00
R1069:Ptprd	UTSW	4	75998487	splice site	probably benign
R1069:Ptprd	UTSW	4	76100633	nonsense	probably null
R1086:Ptprd	UTSW	4	76133258	missense	probably damaging	1.00
R1439:Ptprd	UTSW	4	76066200	missense	probably damaging	1.00
R1440:Ptprd	UTSW	4	76084552	missense	probably damaging	0.98
R1688:Ptprd	UTSW	4	75982684	missense	probably damaging	1.00
R1858:Ptprd	UTSW	4	75947147	missense	probably damaging	1.00
R2001:Ptprd	UTSW	4	75954122	missense	probably damaging	1.00
R2020:Ptprd	UTSW	4	76133161	missense	probably damaging	1.00
R2023:Ptprd	UTSW	4	75957104	missense	probably damaging	1.00
R2413:Ptprd	UTSW	4	76133200	missense	probably damaging	1.00
R2510:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R2914:Ptprd	UTSW	4	75947101	missense	probably damaging	1.00
R2971:Ptprd	UTSW	4	76107324	missense	probably benign	0.10
R3051:Ptprd	UTSW	4	76100630	missense	probably damaging	1.00
R3433:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R3964:Ptprd	UTSW	4	76059836	splice site	probably benign
R4009:Ptprd	UTSW	4	75956397	missense	possibly damaging	0.94
R4394:Ptprd	UTSW	4	76128685	missense	probably damaging	1.00
R4420:Ptprd	UTSW	4	76039377	missense	possibly damaging	0.92
R4424:Ptprd	UTSW	4	76102963	missense	probably benign	0.22
R4575:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4578:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4715:Ptprd	UTSW	4	76107333	missense	probably benign	0.03
R4782:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4785:Ptprd	UTSW	4	76140553	missense	probably benign	0.05
R4799:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4944:Ptprd	UTSW	4	76128899	missense	probably damaging	1.00
R4950:Ptprd	UTSW	4	76140515	splice site	probably null
R4969:Ptprd	UTSW	4	76133305	missense	probably damaging	1.00
R5153:Ptprd	UTSW	4	76012102	missense	probably damaging	1.00
R5164:Ptprd	UTSW	4	76100758	splice site	probably null
R5287:Ptprd	UTSW	4	75954168	nonsense	probably null
R5305:Ptprd	UTSW	4	75982626	missense	probably damaging	1.00
R5362:Ptprd	UTSW	4	76128813	missense	probably damaging	1.00
R5403:Ptprd	UTSW	4	75954168	nonsense	probably null
R5531:Ptprd	UTSW	4	76059667	critical splice donor site	probably null
R5543:Ptprd	UTSW	4	76059753	missense	probably damaging	1.00
R5634:Ptprd	UTSW	4	76072018	missense	probably benign	0.01
R5719:Ptprd	UTSW	4	76054602	critical splice acceptor site	probably null
R5884:Ptprd	UTSW	4	75982690	missense	probably damaging	1.00
R6247:Ptprd	UTSW	4	76066291	missense	probably benign	0.06
R6250:Ptprd	UTSW	4	76128995	missense	probably damaging	1.00
R6335:Ptprd	UTSW	4	75954183	missense	probably damaging	1.00
R6352:Ptprd	UTSW	4	76091552	splice site	probably null
R6533:Ptprd	UTSW	4	76128528	missense	probably damaging	1.00
R6756:Ptprd	UTSW	4	75955299	missense	probably damaging	1.00
R6782:Ptprd	UTSW	4	76325140	splice site	probably null
R7131:Ptprd	UTSW	4	76066340	missense	probably damaging	1.00
R7170:Ptprd	UTSW	4	76071962	missense	probably benign	0.06
R7233:Ptprd	UTSW	4	76059783	missense	probably benign	0.00
R7246:Ptprd	UTSW	4	76128676	missense	probably damaging	1.00
R7413:Ptprd	UTSW	4	76246839	missense	probably benign	0.00
R7428:Ptprd	UTSW	4	76086468	missense	probably benign	0.03
R7442:Ptprd	UTSW	4	76059821	nonsense	probably null
R7491:Ptprd	UTSW	4	76133155	missense	probably benign	0.23
R7526:Ptprd	UTSW	4	76066327	missense	probably benign	0.00
R7609:Ptprd	UTSW	4	76072003	missense	probably benign	0.03
R7612:Ptprd	UTSW	4	76086459	missense	probably benign	0.45
R7659:Ptprd	UTSW	4	76128916	missense	probably benign	0.03
R7743:Ptprd	UTSW	4	76086089	missense	probably damaging	1.00
R7748:Ptprd	UTSW	4	76099504	missense	probably null	0.39
R7788:Ptprd	UTSW	4	75998604	missense	probably damaging	1.00
R7836:Ptprd	UTSW	4	75982644	missense	probably damaging	0.99
R7937:Ptprd	UTSW	4	76095535	missense	probably benign	0.00
R8000:Ptprd	UTSW	4	76066242	missense	possibly damaging	0.95
R8018:Ptprd	UTSW	4	76085520	missense	probably damaging	0.98
R8072:Ptprd	UTSW	4	76086036	missense	probably benign	0.01
R8119:Ptprd	UTSW	4	76129026	missense	probably benign	0.00
R8350:Ptprd	UTSW	4	75950661	missense	probably damaging	1.00
R8387:Ptprd	UTSW	4	75955289	missense	probably damaging	1.00
R8458:Ptprd	UTSW	4	76066259	missense	probably benign	0.00
R8529:Ptprd	UTSW	4	76129025	missense	probably damaging	1.00
R8924:Ptprd	UTSW	4	75998499	critical splice donor site	probably null
R8984:Ptprd	UTSW	4	75945014	missense	probably damaging	1.00
R9024:Ptprd	UTSW	4	75956330	missense	probably damaging	1.00
R9204:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9206:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9259:Ptprd	UTSW	4	76071963	missense	probably damaging	0.99
R9311:Ptprd	UTSW	4	76133083	missense	probably benign	0.25
R9417:Ptprd	UTSW	4	75947098	missense	probably damaging	0.99
R9427:Ptprd	UTSW	4	76133203	missense	probably benign	0.01
R9579:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9580:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9701:Ptprd	UTSW	4	75998659	missense	probably damaging	1.00
RF016:Ptprd	UTSW	4	76128655	missense	probably benign	0.01
RF023:Ptprd	UTSW	4	76128565	missense	probably damaging	0.98
Z1176:Ptprd	UTSW	4	76133214	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGAGCTTCTCCAGATGAGGC -3'
(R):5'- CGTAATTACTTTGAGACCACAGGTTG -3'

Sequencing Primer
(F):5'- TCTCCAGATGAGGCCCTCC -3'
(R):5'- CACAGGTTGGAAGTAGATATGTGATC -3'

Posted On

2021-04-30