Incidental Mutation 'R8699:Ptprd'
ID 668916
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Name protein tyrosine phosphatase receptor type D
Synonyms 1110002J03Rik, B230219D21Rik, 3000002J10Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 75859475-78130198 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75959629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 279 (F279I)
Ref Sequence ENSEMBL: ENSMUSP00000148560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000212365] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831]
AlphaFold Q64487
Predicted Effect probably benign
Transcript: ENSMUST00000050757
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098005
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107289
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173376
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174023
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212365
AA Change: F279I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000174180
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174831
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75,916,793 (GRCm39) nonsense probably null
IGL01067:Ptprd APN 4 75,977,922 (GRCm39) missense probably damaging 1.00
IGL01121:Ptprd APN 4 75,872,438 (GRCm39) splice site probably benign
IGL01531:Ptprd APN 4 76,003,757 (GRCm39) missense probably damaging 0.98
IGL01661:Ptprd APN 4 75,872,320 (GRCm39) missense probably damaging 1.00
IGL01723:Ptprd APN 4 76,161,910 (GRCm39) missense probably damaging 1.00
IGL01735:Ptprd APN 4 76,055,057 (GRCm39) splice site probably null
IGL01810:Ptprd APN 4 76,058,744 (GRCm39) splice site probably benign
IGL01834:Ptprd APN 4 76,046,832 (GRCm39) missense probably damaging 1.00
IGL01835:Ptprd APN 4 76,165,058 (GRCm39) missense probably benign 0.02
IGL01867:Ptprd APN 4 76,161,884 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprd APN 4 75,865,361 (GRCm39) missense probably damaging 1.00
IGL02591:Ptprd APN 4 75,900,287 (GRCm39) missense probably damaging 1.00
IGL02741:Ptprd APN 4 76,051,521 (GRCm39) missense probably damaging 1.00
IGL02866:Ptprd APN 4 75,968,674 (GRCm39) missense probably damaging 1.00
IGL02960:Ptprd APN 4 76,047,105 (GRCm39) missense probably damaging 1.00
IGL03155:Ptprd APN 4 75,984,456 (GRCm39) missense possibly damaging 0.95
IGL03230:Ptprd APN 4 75,968,654 (GRCm39) nonsense probably null
IGL03343:Ptprd APN 4 75,977,966 (GRCm39) missense probably damaging 1.00
unhurried UTSW 4 76,018,870 (GRCm39) nonsense probably null
ANU22:Ptprd UTSW 4 76,018,693 (GRCm39) missense probably damaging 0.99
F5493:Ptprd UTSW 4 76,002,645 (GRCm39) missense probably damaging 1.00
P0033:Ptprd UTSW 4 76,047,091 (GRCm39) nonsense probably null
R0044:Ptprd UTSW 4 76,004,566 (GRCm39) missense probably benign 0.08
R0044:Ptprd UTSW 4 76,004,566 (GRCm39) missense probably benign 0.08
R0076:Ptprd UTSW 4 75,865,276 (GRCm39) splice site probably benign
R0137:Ptprd UTSW 4 76,055,140 (GRCm39) missense probably benign 0.24
R0358:Ptprd UTSW 4 75,863,226 (GRCm39) missense probably damaging 1.00
R0365:Ptprd UTSW 4 76,055,083 (GRCm39) missense probably damaging 1.00
R0385:Ptprd UTSW 4 76,046,902 (GRCm39) missense probably damaging 1.00
R0601:Ptprd UTSW 4 76,018,711 (GRCm39) missense probably benign
R0646:Ptprd UTSW 4 76,002,640 (GRCm39) missense probably damaging 0.99
R0667:Ptprd UTSW 4 75,875,583 (GRCm39) missense probably damaging 1.00
R0707:Ptprd UTSW 4 75,875,476 (GRCm39) missense probably damaging 1.00
R0734:Ptprd UTSW 4 76,058,834 (GRCm39) missense probably damaging 1.00
R0827:Ptprd UTSW 4 76,047,152 (GRCm39) missense probably damaging 0.98
R0932:Ptprd UTSW 4 76,055,122 (GRCm39) missense probably damaging 1.00
R1069:Ptprd UTSW 4 76,018,870 (GRCm39) nonsense probably null
R1069:Ptprd UTSW 4 75,916,724 (GRCm39) splice site probably benign
R1086:Ptprd UTSW 4 76,051,495 (GRCm39) missense probably damaging 1.00
R1439:Ptprd UTSW 4 75,984,437 (GRCm39) missense probably damaging 1.00
R1440:Ptprd UTSW 4 76,002,789 (GRCm39) missense probably damaging 0.98
R1688:Ptprd UTSW 4 75,900,921 (GRCm39) missense probably damaging 1.00
R1858:Ptprd UTSW 4 75,865,384 (GRCm39) missense probably damaging 1.00
R2001:Ptprd UTSW 4 75,872,359 (GRCm39) missense probably damaging 1.00
R2020:Ptprd UTSW 4 76,051,398 (GRCm39) missense probably damaging 1.00
R2023:Ptprd UTSW 4 75,875,341 (GRCm39) missense probably damaging 1.00
R2413:Ptprd UTSW 4 76,051,437 (GRCm39) missense probably damaging 1.00
R2510:Ptprd UTSW 4 76,004,248 (GRCm39) critical splice donor site probably null
R2914:Ptprd UTSW 4 75,865,338 (GRCm39) missense probably damaging 1.00
R2971:Ptprd UTSW 4 76,025,561 (GRCm39) missense probably benign 0.10
R3051:Ptprd UTSW 4 76,018,867 (GRCm39) missense probably damaging 1.00
R3433:Ptprd UTSW 4 76,004,248 (GRCm39) critical splice donor site probably null
R3964:Ptprd UTSW 4 75,978,073 (GRCm39) splice site probably benign
R4009:Ptprd UTSW 4 75,874,634 (GRCm39) missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76,046,922 (GRCm39) missense probably damaging 1.00
R4420:Ptprd UTSW 4 75,957,614 (GRCm39) missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76,021,200 (GRCm39) missense probably benign 0.22
R4575:Ptprd UTSW 4 76,162,023 (GRCm39) missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76,162,023 (GRCm39) missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76,025,570 (GRCm39) missense probably benign 0.03
R4782:Ptprd UTSW 4 76,009,769 (GRCm39) missense probably benign 0.01
R4785:Ptprd UTSW 4 76,058,790 (GRCm39) missense probably benign 0.05
R4799:Ptprd UTSW 4 76,009,769 (GRCm39) missense probably benign 0.01
R4944:Ptprd UTSW 4 76,047,136 (GRCm39) missense probably damaging 1.00
R4950:Ptprd UTSW 4 76,058,752 (GRCm39) splice site probably null
R4969:Ptprd UTSW 4 76,051,542 (GRCm39) missense probably damaging 1.00
R5153:Ptprd UTSW 4 75,930,339 (GRCm39) missense probably damaging 1.00
R5164:Ptprd UTSW 4 76,018,995 (GRCm39) splice site probably null
R5287:Ptprd UTSW 4 75,872,405 (GRCm39) nonsense probably null
R5305:Ptprd UTSW 4 75,900,863 (GRCm39) missense probably damaging 1.00
R5362:Ptprd UTSW 4 76,047,050 (GRCm39) missense probably damaging 1.00
R5403:Ptprd UTSW 4 75,872,405 (GRCm39) nonsense probably null
R5531:Ptprd UTSW 4 75,977,904 (GRCm39) critical splice donor site probably null
R5543:Ptprd UTSW 4 75,977,990 (GRCm39) missense probably damaging 1.00
R5634:Ptprd UTSW 4 75,990,255 (GRCm39) missense probably benign 0.01
R5719:Ptprd UTSW 4 75,972,839 (GRCm39) critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75,900,927 (GRCm39) missense probably damaging 1.00
R6247:Ptprd UTSW 4 75,984,528 (GRCm39) missense probably benign 0.06
R6250:Ptprd UTSW 4 76,047,232 (GRCm39) missense probably damaging 1.00
R6335:Ptprd UTSW 4 75,872,420 (GRCm39) missense probably damaging 1.00
R6352:Ptprd UTSW 4 76,009,789 (GRCm39) splice site probably null
R6533:Ptprd UTSW 4 76,046,765 (GRCm39) missense probably damaging 1.00
R6756:Ptprd UTSW 4 75,873,536 (GRCm39) missense probably damaging 1.00
R6782:Ptprd UTSW 4 76,243,377 (GRCm39) splice site probably null
R7131:Ptprd UTSW 4 75,984,577 (GRCm39) missense probably damaging 1.00
R7170:Ptprd UTSW 4 75,990,199 (GRCm39) missense probably benign 0.06
R7233:Ptprd UTSW 4 75,978,020 (GRCm39) missense probably benign 0.00
R7246:Ptprd UTSW 4 76,046,913 (GRCm39) missense probably damaging 1.00
R7413:Ptprd UTSW 4 76,165,076 (GRCm39) missense probably benign 0.00
R7428:Ptprd UTSW 4 76,004,705 (GRCm39) missense probably benign 0.03
R7442:Ptprd UTSW 4 75,978,058 (GRCm39) nonsense probably null
R7491:Ptprd UTSW 4 76,051,392 (GRCm39) missense probably benign 0.23
R7526:Ptprd UTSW 4 75,984,564 (GRCm39) missense probably benign 0.00
R7609:Ptprd UTSW 4 75,990,240 (GRCm39) missense probably benign 0.03
R7612:Ptprd UTSW 4 76,004,696 (GRCm39) missense probably benign 0.45
R7659:Ptprd UTSW 4 76,047,153 (GRCm39) missense probably benign 0.03
R7743:Ptprd UTSW 4 76,004,326 (GRCm39) missense probably damaging 1.00
R7748:Ptprd UTSW 4 76,017,741 (GRCm39) missense probably null 0.39
R7788:Ptprd UTSW 4 75,916,841 (GRCm39) missense probably damaging 1.00
R7836:Ptprd UTSW 4 75,900,881 (GRCm39) missense probably damaging 0.99
R7937:Ptprd UTSW 4 76,013,772 (GRCm39) missense probably benign 0.00
R8000:Ptprd UTSW 4 75,984,479 (GRCm39) missense possibly damaging 0.95
R8018:Ptprd UTSW 4 76,003,757 (GRCm39) missense probably damaging 0.98
R8072:Ptprd UTSW 4 76,004,273 (GRCm39) missense probably benign 0.01
R8119:Ptprd UTSW 4 76,047,263 (GRCm39) missense probably benign 0.00
R8350:Ptprd UTSW 4 75,868,898 (GRCm39) missense probably damaging 1.00
R8387:Ptprd UTSW 4 75,873,526 (GRCm39) missense probably damaging 1.00
R8458:Ptprd UTSW 4 75,984,496 (GRCm39) missense probably benign 0.00
R8529:Ptprd UTSW 4 76,047,262 (GRCm39) missense probably damaging 1.00
R8924:Ptprd UTSW 4 75,916,736 (GRCm39) critical splice donor site probably null
R8984:Ptprd UTSW 4 75,863,251 (GRCm39) missense probably damaging 1.00
R9024:Ptprd UTSW 4 75,874,567 (GRCm39) missense probably damaging 1.00
R9204:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9206:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9259:Ptprd UTSW 4 75,990,200 (GRCm39) missense probably damaging 0.99
R9311:Ptprd UTSW 4 76,051,320 (GRCm39) missense probably benign 0.25
R9417:Ptprd UTSW 4 75,865,335 (GRCm39) missense probably damaging 0.99
R9427:Ptprd UTSW 4 76,051,440 (GRCm39) missense probably benign 0.01
R9579:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9580:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9701:Ptprd UTSW 4 75,916,896 (GRCm39) missense probably damaging 1.00
RF016:Ptprd UTSW 4 76,046,892 (GRCm39) missense probably benign 0.01
RF023:Ptprd UTSW 4 76,046,802 (GRCm39) missense probably damaging 0.98
Z1176:Ptprd UTSW 4 76,051,451 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGAGCTTCTCCAGATGAGGC -3'
(R):5'- CGTAATTACTTTGAGACCACAGGTTG -3'

Sequencing Primer
(F):5'- TCTCCAGATGAGGCCCTCC -3'
(R):5'- CACAGGTTGGAAGTAGATATGTGATC -3'
Posted On 2021-04-30