Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Cad'

668920

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31054780-31078479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31076261 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1951 (V1951A)

Ref Sequence

ENSEMBL: ENSMUSP00000013773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]

AlphaFold

B2RQC6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000013773
AA Change: V1951A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: V1951A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000200953
AA Change: V1888A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: V1888A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201182
AA Change: V1951A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: V1951A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202795
AA Change: V1951A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: V1951A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202973

SMART Domains

Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
SCOP:d1gkra1	1	84	4e-28	SMART
PDB:4C6N\|A	1	119	4e-58	PDB
low complexity region	156	170	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31061484	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31059054	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31061770	splice site	probably benign
IGL01638:Cad	APN	5	31067614	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31060826	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31069604	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31055294	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31054986	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31072094	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31078110	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31072321	missense	probably benign	0.01
R0335:Cad	UTSW	5	31073985	unclassified	probably benign
R0401:Cad	UTSW	5	31073986	unclassified	probably benign
R0445:Cad	UTSW	5	31072709	missense	probably benign	0.08
R0494:Cad	UTSW	5	31077512	unclassified	probably benign
R0532:Cad	UTSW	5	31062187	splice site	probably benign
R0539:Cad	UTSW	5	31075457	splice site	probably benign
R0578:Cad	UTSW	5	31058776	missense	probably benign	0.01
R0590:Cad	UTSW	5	31062231	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31077688	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31067600	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31059582	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31068762	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31076219	missense	probably benign	0.14
R1763:Cad	UTSW	5	31060951	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31062220	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31061674	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31074137	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31075546	splice site	probably null
R3847:Cad	UTSW	5	31061650	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31074022	missense	probably benign	0.06
R3943:Cad	UTSW	5	31072385	critical splice donor site	probably null
R4213:Cad	UTSW	5	31072344	missense	probably benign	0.01
R4458:Cad	UTSW	5	31061226	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31058133	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31070295	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31066686	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31074690	missense	probably benign	0.02
R5044:Cad	UTSW	5	31055021	missense	probably benign	0.00
R5630:Cad	UTSW	5	31060573	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31076847	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31069112	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31054983	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31062562	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31072978	missense	probably benign	0.00
R6260:Cad	UTSW	5	31066800	missense	probably null
R7145:Cad	UTSW	5	31067612	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31060213	critical splice donor site	probably null
R7352:Cad	UTSW	5	31058078	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31075829	missense	probably benign
R7387:Cad	UTSW	5	31061940	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31074162	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31069048	missense	probably benign
R7627:Cad	UTSW	5	31060164	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31061485	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31068806	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31060927	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31075821	missense	probably benign	0.00
R8523:Cad	UTSW	5	31058106	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31075156	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31074601	missense	probably benign	0.06
R8698:Cad	UTSW	5	31077475	missense	probably benign
R8803:Cad	UTSW	5	31069564	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31067665	missense	probably null
R9272:Cad	UTSW	5	31061232	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31072656	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31077644	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31070674	critical splice donor site	probably null
R9665:Cad	UTSW	5	31072359	missense	probably benign	0.28
RF001:Cad	UTSW	5	31060212	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31060212	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31068131	missense	probably null	1.00
X0022:Cad	UTSW	5	31072317	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31068421	missense	probably damaging	1.00
Z1177:Cad	UTSW	5	31075128	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TCCTGTCTGTCAAGCAGTTC -3'
(R):5'- TTGCAAATGTCAACGGCTGC -3'

Sequencing Primer
(F):5'- CAGTTCACTAAGGATCAGGTACCTG -3'
(R):5'- ATTCAGATCAGATGACCCCATATG -3'

Posted On

2021-04-30