Incidental Mutation 'R8699:Cad'
ID668920
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31076261 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1951 (V1951A)
Ref Sequence ENSEMBL: ENSMUSP00000013773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013773
AA Change: V1951A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: V1951A

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200953
AA Change: V1888A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: V1888A

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201182
AA Change: V1951A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: V1951A

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202795
AA Change: V1951A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: V1951A

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202973
SMART Domains Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
SCOP:d1gkra1 1 84 4e-28 SMART
PDB:4C6N|A 1 119 4e-58 PDB
low complexity region 156 170 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 splice site probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7627:Cad UTSW 5 31060164 missense probably damaging 1.00
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
R8115:Cad UTSW 5 31060927 missense possibly damaging 0.82
R8511:Cad UTSW 5 31075821 missense probably benign 0.00
R8523:Cad UTSW 5 31058106 missense probably damaging 0.98
R8690:Cad UTSW 5 31075156 missense possibly damaging 0.58
R8697:Cad UTSW 5 31074601 missense probably benign 0.06
R8698:Cad UTSW 5 31077475 missense probably benign
R8803:Cad UTSW 5 31069564 missense probably damaging 1.00
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCCTGTCTGTCAAGCAGTTC -3'
(R):5'- TTGCAAATGTCAACGGCTGC -3'

Sequencing Primer
(F):5'- CAGTTCACTAAGGATCAGGTACCTG -3'
(R):5'- ATTCAGATCAGATGACCCCATATG -3'
Posted On2021-04-30