Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Bicra'

668928

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 15989188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 135 (Q135K)

Ref Sequence

ENSEMBL: ENSMUSP00000148012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]

AlphaFold

F8VPZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000094821
AA Change: Q135K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: Q135K

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210713

Predicted Effect

probably benign
Transcript: ENSMUST00000210781
AA Change: Q135K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0688:Bicra	UTSW	7	15989322	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R3551:Bicra	UTSW	7	15979733	missense	probably benign	0.33
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5035:Bicra	UTSW	7	15979424	missense	possibly damaging	0.90
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6541:Bicra	UTSW	7	15979129	missense	probably benign	0.00
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7283:Bicra	UTSW	7	15972500	missense	probably damaging	1.00
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
R8784:Bicra	UTSW	7	15971950	missense	probably damaging	1.00
R8859:Bicra	UTSW	7	15987812	missense	possibly damaging	0.73
R8971:Bicra	UTSW	7	15987556	missense	probably benign	0.08
R9487:Bicra	UTSW	7	15971792	missense	probably damaging	0.99
R9614:Bicra	UTSW	7	15971955	missense	probably damaging	1.00
R9721:Bicra	UTSW	7	15979176	missense	probably damaging	1.00
R9777:Bicra	UTSW	7	15972062	missense	probably benign	0.09
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAAATGGGCTGAAGGGTCAC -3'
(R):5'- TGATATCTTGGGCTCCCCTG -3'

Sequencing Primer
(F):5'- TGAAGGGTCACATTGCCCAG -3'
(R):5'- CTGCAGCAGGAGGAGGTG -3'

Posted On

2021-04-30