Incidental Mutation 'R8699:Map3k10'
ID668931
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27668355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 286 (V286D)
Ref Sequence ENSEMBL: ENSMUSP00000037725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036453] [ENSMUST00000108341] [ENSMUST00000138243]
Predicted Effect probably damaging
Transcript: ENSMUST00000036453
AA Change: V286D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: V286D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108341
AA Change: V286D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: V286D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138243
AA Change: V286D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0039:Map3k10 UTSW 7 27658098 missense possibly damaging 0.95
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0724:Map3k10 UTSW 7 27668355 missense probably damaging 1.00
R0729:Map3k10 UTSW 7 27661567 missense probably damaging 1.00
R1734:Map3k10 UTSW 7 27658115 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 splice site probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R2517:Map3k10 UTSW 7 27663263 missense possibly damaging 0.92
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R7903:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
R8118:Map3k10 UTSW 7 27673417 missense possibly damaging 0.91
R8191:Map3k10 UTSW 7 27663246 missense probably damaging 0.99
R8336:Map3k10 UTSW 7 27673459 missense probably benign 0.25
R8697:Map3k10 UTSW 7 27663359 missense probably benign 0.13
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAATGACTACGCAGTGGG -3'
(R):5'- AATCCTGGAGGCCATTGAGAAC -3'

Sequencing Primer
(F):5'- TCAGAAGCCCTTTAGTGCTAAC -3'
(R):5'- TTGAGAACCACAACCTCGCTG -3'
Posted On2021-04-30