Incidental Mutation 'R8699:Zfp788'
ID668932
Institutional Source Beutler Lab
Gene Symbol Zfp788
Ensembl Gene ENSMUSG00000074165
Gene Namezinc finger protein 788
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41633203-41651530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41648416 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 159 (N159D)
Ref Sequence ENSEMBL: ENSMUSP00000096108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045720] [ENSMUST00000098508] [ENSMUST00000100275] [ENSMUST00000131180] [ENSMUST00000140964] [ENSMUST00000154942] [ENSMUST00000170770]
Predicted Effect probably benign
Transcript: ENSMUST00000045720
AA Change: N139D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000035499
Gene: ENSMUSG00000074165
AA Change: N139D

DomainStartEndE-ValueType
KRAB 4 67 7.82e-17 SMART
ZnF_C2H2 218 240 2.53e-2 SMART
ZnF_C2H2 246 268 2.71e-2 SMART
ZnF_C2H2 274 296 8.47e-4 SMART
ZnF_C2H2 302 324 3.16e-3 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 4.54e-4 SMART
ZnF_C2H2 386 408 1.36e-2 SMART
ZnF_C2H2 414 436 2.24e-3 SMART
ZnF_C2H2 442 464 5.14e-3 SMART
ZnF_C2H2 470 492 5.14e-3 SMART
ZnF_C2H2 498 520 5.42e-2 SMART
ZnF_C2H2 526 548 8.6e-5 SMART
ZnF_C2H2 554 576 1.53e-1 SMART
ZnF_C2H2 582 604 2.4e-3 SMART
ZnF_C2H2 610 632 8.81e-2 SMART
ZnF_C2H2 638 660 9.58e-3 SMART
ZnF_C2H2 666 688 4.54e-4 SMART
ZnF_C2H2 694 716 1.1e-2 SMART
ZnF_C2H2 722 744 3.63e-3 SMART
ZnF_C2H2 750 772 8.94e-3 SMART
ZnF_C2H2 778 800 1.5e-4 SMART
ZnF_C2H2 806 828 4.24e-4 SMART
ZnF_C2H2 834 856 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098508
AA Change: N159D

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096108
Gene: ENSMUSG00000074165
AA Change: N159D

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
ZnF_C2H2 238 260 2.53e-2 SMART
ZnF_C2H2 266 288 2.71e-2 SMART
ZnF_C2H2 294 316 8.47e-4 SMART
ZnF_C2H2 322 344 3.16e-3 SMART
ZnF_C2H2 350 372 1.38e-3 SMART
ZnF_C2H2 378 400 4.54e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 2.24e-3 SMART
ZnF_C2H2 462 484 5.14e-3 SMART
ZnF_C2H2 490 512 5.14e-3 SMART
ZnF_C2H2 518 540 5.42e-2 SMART
ZnF_C2H2 546 568 8.6e-5 SMART
ZnF_C2H2 574 596 1.53e-1 SMART
ZnF_C2H2 602 624 2.4e-3 SMART
ZnF_C2H2 630 652 8.81e-2 SMART
ZnF_C2H2 658 680 9.58e-3 SMART
ZnF_C2H2 686 708 4.54e-4 SMART
ZnF_C2H2 714 736 1.1e-2 SMART
ZnF_C2H2 742 764 3.63e-3 SMART
ZnF_C2H2 770 792 8.94e-3 SMART
ZnF_C2H2 798 820 1.5e-4 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
ZnF_C2H2 854 876 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100275
AA Change: N107D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097847
Gene: ENSMUSG00000074165
AA Change: N107D

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131180
SMART Domains Protein: ENSMUSP00000114542
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140964
AA Change: N107D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116050
Gene: ENSMUSG00000074165
AA Change: N107D

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154942
Predicted Effect possibly damaging
Transcript: ENSMUST00000170770
AA Change: N107D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132848
Gene: ENSMUSG00000074165
AA Change: N107D

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Other mutations in Zfp788
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Zfp788 UTSW 7 41649625 nonsense probably null
BB017:Zfp788 UTSW 7 41649625 nonsense probably null
R0207:Zfp788 UTSW 7 41649596 missense probably damaging 1.00
R0320:Zfp788 UTSW 7 41649547 missense probably damaging 1.00
R0608:Zfp788 UTSW 7 41648281 missense possibly damaging 0.53
R1184:Zfp788 UTSW 7 41648326 missense probably damaging 1.00
R1483:Zfp788 UTSW 7 41649075 nonsense probably null
R1985:Zfp788 UTSW 7 41650481 missense probably damaging 0.98
R2030:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R2207:Zfp788 UTSW 7 41649640 missense probably damaging 0.99
R2313:Zfp788 UTSW 7 41648888 missense probably damaging 0.99
R3791:Zfp788 UTSW 7 41649728 missense probably damaging 0.99
R3872:Zfp788 UTSW 7 41649444 nonsense probably null
R4126:Zfp788 UTSW 7 41649436 missense probably damaging 0.97
R4579:Zfp788 UTSW 7 41647594 missense probably benign 0.00
R4833:Zfp788 UTSW 7 41647568 missense probably benign 0.31
R5076:Zfp788 UTSW 7 41648584 missense possibly damaging 0.93
R5175:Zfp788 UTSW 7 41649329 missense probably damaging 1.00
R5225:Zfp788 UTSW 7 41649556 missense probably benign 0.16
R5364:Zfp788 UTSW 7 41650127 missense probably damaging 1.00
R5427:Zfp788 UTSW 7 41649652 missense possibly damaging 0.82
R5484:Zfp788 UTSW 7 41649853 missense probably damaging 0.96
R5659:Zfp788 UTSW 7 41650116 nonsense probably null
R5917:Zfp788 UTSW 7 41649148 missense probably benign
R6064:Zfp788 UTSW 7 41648454 missense probably benign 0.18
R6128:Zfp788 UTSW 7 41650361 missense probably damaging 1.00
R6144:Zfp788 UTSW 7 41649769 missense probably damaging 0.97
R6182:Zfp788 UTSW 7 41650516 missense probably damaging 0.98
R6299:Zfp788 UTSW 7 41648541 missense possibly damaging 0.81
R6823:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R6974:Zfp788 UTSW 7 41649877 nonsense probably null
R7497:Zfp788 UTSW 7 41648851 missense possibly damaging 0.92
R7930:Zfp788 UTSW 7 41649625 nonsense probably null
R7979:Zfp788 UTSW 7 41634900 critical splice donor site probably null
R8178:Zfp788 UTSW 7 41648911 missense probably damaging 1.00
R8193:Zfp788 UTSW 7 41648614 missense probably benign 0.35
R8195:Zfp788 UTSW 7 41649377 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATCAATCTGGAGAAATCTTCACC -3'
(R):5'- TCTTCCACGACTTTCACAGG -3'

Sequencing Primer
(F):5'- TGGAGAAATCTTCACCAAGACAC -3'
(R):5'- GCTCGGAGCTCTACCAAATG -3'
Posted On2021-04-30