Incidental Mutation 'R8699:Cntnap4'
ID 668938
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Name contactin associated protein-like 4
Synonyms Caspr4, E130114F09Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 113296675-113609349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113484228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 427 (D427V)
Ref Sequence ENSEMBL: ENSMUSP00000034225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
AlphaFold Q99P47
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: D427V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: D427V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: D427V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: D427V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 113,494,251 (GRCm39) splice site probably benign
IGL01898:Cntnap4 APN 8 113,582,939 (GRCm39) missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 113,478,866 (GRCm39) missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 113,343,126 (GRCm39) missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 113,512,535 (GRCm39) splice site probably benign
IGL02621:Cntnap4 APN 8 113,537,355 (GRCm39) missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 113,500,222 (GRCm39) missense probably benign 0.06
IGL03327:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
IGL03346:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 113,512,416 (GRCm39) missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 113,569,148 (GRCm39) critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 113,583,143 (GRCm39) nonsense probably null
R0497:Cntnap4 UTSW 8 113,296,783 (GRCm39) missense probably benign 0.00
R1495:Cntnap4 UTSW 8 113,608,395 (GRCm39) missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 113,608,462 (GRCm39) missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 113,484,155 (GRCm39) missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 113,542,128 (GRCm39) missense probably benign 0.10
R2160:Cntnap4 UTSW 8 113,484,203 (GRCm39) missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 113,484,071 (GRCm39) missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R3917:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R4097:Cntnap4 UTSW 8 113,478,939 (GRCm39) missense probably benign 0.03
R4348:Cntnap4 UTSW 8 113,480,554 (GRCm39) missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 113,391,898 (GRCm39) missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 113,584,842 (GRCm39) missense probably benign 0.32
R4531:Cntnap4 UTSW 8 113,537,240 (GRCm39) missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 113,537,342 (GRCm39) missense probably benign
R4611:Cntnap4 UTSW 8 113,500,371 (GRCm39) critical splice donor site probably null
R4675:Cntnap4 UTSW 8 113,512,468 (GRCm39) missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 113,460,070 (GRCm39) missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 113,568,385 (GRCm39) missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 113,602,061 (GRCm39) missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 113,569,353 (GRCm39) missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 113,529,843 (GRCm39) missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 113,478,921 (GRCm39) missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 113,484,105 (GRCm39) missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 113,529,858 (GRCm39) missense probably benign 0.03
R7031:Cntnap4 UTSW 8 113,584,874 (GRCm39) missense probably benign 0.01
R7107:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 113,537,268 (GRCm39) missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 113,608,432 (GRCm39) missense probably benign 0.05
R7232:Cntnap4 UTSW 8 113,391,731 (GRCm39) splice site probably null
R7348:Cntnap4 UTSW 8 113,391,909 (GRCm39) missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 113,460,194 (GRCm39) critical splice donor site probably null
R7832:Cntnap4 UTSW 8 113,484,113 (GRCm39) missense probably benign
R7895:Cntnap4 UTSW 8 113,478,829 (GRCm39) missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 113,480,577 (GRCm39) missense probably damaging 0.99
R8185:Cntnap4 UTSW 8 113,391,897 (GRCm39) missense probably damaging 1.00
R8197:Cntnap4 UTSW 8 113,296,857 (GRCm39) missense probably benign 0.00
R8287:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
R8299:Cntnap4 UTSW 8 113,500,324 (GRCm39) missense probably damaging 1.00
R8498:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense possibly damaging 0.52
R8774:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8774-TAIL:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8872:Cntnap4 UTSW 8 113,585,759 (GRCm39) missense possibly damaging 0.79
R8895:Cntnap4 UTSW 8 113,479,598 (GRCm39) missense probably benign 0.40
R8965:Cntnap4 UTSW 8 113,479,646 (GRCm39) missense probably damaging 1.00
R9189:Cntnap4 UTSW 8 113,602,600 (GRCm39) missense possibly damaging 0.92
R9260:Cntnap4 UTSW 8 113,500,276 (GRCm39) missense probably benign 0.08
R9474:Cntnap4 UTSW 8 113,460,103 (GRCm39) missense probably damaging 0.99
R9565:Cntnap4 UTSW 8 113,582,982 (GRCm39) missense probably benign 0.43
R9625:Cntnap4 UTSW 8 113,602,181 (GRCm39) missense possibly damaging 0.82
R9629:Cntnap4 UTSW 8 113,568,349 (GRCm39) missense probably damaging 1.00
R9745:Cntnap4 UTSW 8 113,391,808 (GRCm39) missense possibly damaging 0.89
R9765:Cntnap4 UTSW 8 113,568,496 (GRCm39) missense probably damaging 0.97
R9765:Cntnap4 UTSW 8 113,484,110 (GRCm39) missense probably benign 0.00
R9793:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
R9795:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
X0025:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 113,542,152 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 113,584,821 (GRCm39) missense possibly damaging 0.70
Z1186:Cntnap4 UTSW 8 113,479,002 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCACAGTCTATGCCTCTGAC -3'
(R):5'- TGGATGGAAATTTCTACTCCCTC -3'

Sequencing Primer
(F):5'- TGACTTTTCTGAGCCCCAGGAG -3'
(R):5'- TCCTCTAAGGAAAGGTACTGATAATC -3'
Posted On 2021-04-30