Incidental Mutation 'R8699:Rgs17'
ID 668943
Institutional Source Beutler Lab
Gene Symbol Rgs17
Ensembl Gene ENSMUSG00000019775
Gene Name regulator of G-protein signaling 17
Synonyms 6430507P11Rik, RGSZ2
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 5775663-5872400 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5868194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 9 (L9M)
Ref Sequence ENSEMBL: ENSMUSP00000065825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019909] [ENSMUST00000064225] [ENSMUST00000117676] [ENSMUST00000131996]
AlphaFold Q9QZB0
Predicted Effect probably benign
Transcript: ENSMUST00000019909
SMART Domains Protein: ENSMUSP00000019909
Gene: ENSMUSG00000019775

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 163 7.96e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064225
AA Change: L9M

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065825
Gene: ENSMUSG00000019775
AA Change: L9M

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
RGS 104 220 4.54e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117676
SMART Domains Protein: ENSMUSP00000113519
Gene: ENSMUSG00000019775

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 200 4.54e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131996
SMART Domains Protein: ENSMUSP00000116291
Gene: ENSMUSG00000019775

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 200 4.54e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein contains a conserved, 120 amino acid motif called the RGS domain and a cysteine-rich region. The protein attenuates the signaling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Rgs17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Rgs17 APN 10 5,862,624 (GRCm38) missense possibly damaging 0.80
R0099:Rgs17 UTSW 10 5,792,583 (GRCm39) missense probably benign 0.18
R1564:Rgs17 UTSW 10 5,792,567 (GRCm39) nonsense probably null
R2424:Rgs17 UTSW 10 5,792,560 (GRCm39) missense probably benign 0.33
R2424:Rgs17 UTSW 10 5,783,111 (GRCm39) missense probably damaging 1.00
R4519:Rgs17 UTSW 10 5,868,192 (GRCm39) missense probably benign 0.00
R4585:Rgs17 UTSW 10 5,792,596 (GRCm39) missense probably benign 0.00
R5738:Rgs17 UTSW 10 5,783,140 (GRCm39) missense probably damaging 1.00
R6744:Rgs17 UTSW 10 5,792,567 (GRCm39) missense possibly damaging 0.55
R7625:Rgs17 UTSW 10 5,791,488 (GRCm39) missense probably benign
R7816:Rgs17 UTSW 10 5,791,501 (GRCm39) missense probably benign
R7937:Rgs17 UTSW 10 5,783,078 (GRCm39) missense probably benign 0.02
R8302:Rgs17 UTSW 10 5,812,525 (GRCm39) missense possibly damaging 0.79
R9509:Rgs17 UTSW 10 5,812,576 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCCATAGTCTTTACCATTGAGC -3'
(R):5'- GCAAAGTAACTCATCGGATGC -3'

Sequencing Primer
(F):5'- ATAGTCTTTACCATTGAGCTTTTCC -3'
(R):5'- AGTAACTCATCGGATGCATGAC -3'
Posted On 2021-04-30