Incidental Mutation 'R8699:Dync2i1'
ID 668950
Institutional Source Beutler Lab
Gene Symbol Dync2i1
Ensembl Gene ENSMUSG00000042050
Gene Name dynein 2 intermediate chain 1
Synonyms Dync2l1, D430033N04Rik, Wdr60
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116169882-116226642 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116171321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 972 (T972A)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349]
AlphaFold Q8C761
Predicted Effect probably benign
Transcript: ENSMUST00000039349
AA Change: T972A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: T972A

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Dync2i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dync2i1 APN 12 116,205,400 (GRCm39) missense probably benign 0.01
IGL00668:Dync2i1 APN 12 116,221,048 (GRCm39) missense probably benign 0.32
IGL00914:Dync2i1 APN 12 116,196,223 (GRCm39) missense probably damaging 1.00
IGL01061:Dync2i1 APN 12 116,193,324 (GRCm39) missense probably benign 0.45
IGL01375:Dync2i1 APN 12 116,193,296 (GRCm39) missense possibly damaging 0.91
IGL01758:Dync2i1 APN 12 116,182,418 (GRCm39) missense possibly damaging 0.82
IGL01930:Dync2i1 APN 12 116,189,583 (GRCm39) critical splice donor site probably null
IGL02028:Dync2i1 APN 12 116,219,681 (GRCm39) missense probably benign 0.06
IGL03180:Dync2i1 APN 12 116,182,485 (GRCm39) missense probably benign 0.07
F5770:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
R0153:Dync2i1 UTSW 12 116,196,256 (GRCm39) missense probably benign 0.01
R0265:Dync2i1 UTSW 12 116,221,026 (GRCm39) splice site probably benign
R0364:Dync2i1 UTSW 12 116,221,097 (GRCm39) splice site probably benign
R0601:Dync2i1 UTSW 12 116,219,555 (GRCm39) missense possibly damaging 0.79
R0624:Dync2i1 UTSW 12 116,211,910 (GRCm39) missense probably damaging 0.98
R0755:Dync2i1 UTSW 12 116,175,412 (GRCm39) missense probably benign 0.01
R1023:Dync2i1 UTSW 12 116,196,277 (GRCm39) missense probably damaging 1.00
R1065:Dync2i1 UTSW 12 116,219,696 (GRCm39) missense probably damaging 0.98
R1543:Dync2i1 UTSW 12 116,195,404 (GRCm39) splice site probably benign
R1663:Dync2i1 UTSW 12 116,193,230 (GRCm39) missense probably benign 0.01
R1678:Dync2i1 UTSW 12 116,189,590 (GRCm39) missense probably damaging 1.00
R1719:Dync2i1 UTSW 12 116,219,532 (GRCm39) missense probably benign
R1755:Dync2i1 UTSW 12 116,189,649 (GRCm39) missense probably damaging 0.98
R1832:Dync2i1 UTSW 12 116,171,363 (GRCm39) missense probably damaging 0.99
R1918:Dync2i1 UTSW 12 116,196,221 (GRCm39) missense probably damaging 0.96
R2291:Dync2i1 UTSW 12 116,193,191 (GRCm39) splice site probably null
R2444:Dync2i1 UTSW 12 116,196,289 (GRCm39) missense possibly damaging 0.93
R3419:Dync2i1 UTSW 12 116,188,597 (GRCm39) missense probably benign 0.05
R3699:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R3700:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R4445:Dync2i1 UTSW 12 116,171,335 (GRCm39) missense probably damaging 1.00
R4664:Dync2i1 UTSW 12 116,219,831 (GRCm39) missense probably damaging 0.99
R4954:Dync2i1 UTSW 12 116,219,645 (GRCm39) missense probably damaging 1.00
R5057:Dync2i1 UTSW 12 116,177,033 (GRCm39) missense probably benign 0.43
R5163:Dync2i1 UTSW 12 116,219,486 (GRCm39) missense possibly damaging 0.76
R5341:Dync2i1 UTSW 12 116,219,534 (GRCm39) missense possibly damaging 0.51
R5560:Dync2i1 UTSW 12 116,181,733 (GRCm39) missense probably damaging 0.98
R5870:Dync2i1 UTSW 12 116,219,865 (GRCm39) missense possibly damaging 0.94
R5925:Dync2i1 UTSW 12 116,197,014 (GRCm39) missense possibly damaging 0.82
R6223:Dync2i1 UTSW 12 116,221,078 (GRCm39) missense possibly damaging 0.95
R6364:Dync2i1 UTSW 12 116,205,352 (GRCm39) missense probably damaging 1.00
R6450:Dync2i1 UTSW 12 116,210,347 (GRCm39) nonsense probably null
R6462:Dync2i1 UTSW 12 116,193,251 (GRCm39) missense probably benign
R6751:Dync2i1 UTSW 12 116,177,076 (GRCm39) missense possibly damaging 0.52
R6896:Dync2i1 UTSW 12 116,193,291 (GRCm39) missense possibly damaging 0.52
R6962:Dync2i1 UTSW 12 116,175,398 (GRCm39) missense probably damaging 1.00
R7033:Dync2i1 UTSW 12 116,175,511 (GRCm39) missense probably benign 0.03
R7042:Dync2i1 UTSW 12 116,218,061 (GRCm39) missense probably benign 0.02
R7254:Dync2i1 UTSW 12 116,226,205 (GRCm39) intron probably benign
R7567:Dync2i1 UTSW 12 116,218,130 (GRCm39) splice site probably null
R7889:Dync2i1 UTSW 12 116,219,559 (GRCm39) nonsense probably null
R8082:Dync2i1 UTSW 12 116,177,127 (GRCm39) critical splice acceptor site probably null
R8288:Dync2i1 UTSW 12 116,177,345 (GRCm39) missense probably damaging 1.00
R8309:Dync2i1 UTSW 12 116,219,705 (GRCm39) missense probably damaging 1.00
R8682:Dync2i1 UTSW 12 116,188,610 (GRCm39) missense probably damaging 1.00
R8683:Dync2i1 UTSW 12 116,193,262 (GRCm39) missense probably benign 0.03
R8782:Dync2i1 UTSW 12 116,205,332 (GRCm39) missense probably damaging 1.00
R8809:Dync2i1 UTSW 12 116,193,234 (GRCm39) missense probably damaging 0.98
R9281:Dync2i1 UTSW 12 116,211,677 (GRCm39) nonsense probably null
R9530:Dync2i1 UTSW 12 116,175,411 (GRCm39) missense possibly damaging 0.87
R9751:Dync2i1 UTSW 12 116,205,403 (GRCm39) critical splice acceptor site probably null
V7581:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7582:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7583:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
X0063:Dync2i1 UTSW 12 116,219,489 (GRCm39) missense probably benign
Z1177:Dync2i1 UTSW 12 116,209,719 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAGCTTTCTGGACATCACTTG -3'
(R):5'- TTTCATGGATCTGCCCAGACC -3'

Sequencing Primer
(F):5'- AGCTTTCTGGACATCACTTGATATTC -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
Posted On 2021-04-30