Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Appl1'

668953

Institutional Source

Beutler Lab

Gene Symbol

Appl1

Ensembl Gene

ENSMUSG00000040760

Gene Name

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Synonyms

7330406P05Rik, 2900057D21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26918988-26971232 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 26940255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 490 (S490L)

Ref Sequence

ENSEMBL: ENSMUSP00000042875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036570]

AlphaFold

Q8K3H0

Predicted Effect

probably benign
Transcript: ENSMUST00000036570
AA Change: S490L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: S490L

Domain	Start	End	E-Value	Type
Pfam:BAR_3	7	249	2.6e-66	PFAM
PH	278	377	1.4e-3	SMART
low complexity region	425	434	N/A	INTRINSIC
Pfam:PID	501	632	6.6e-12	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	679	700	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Appl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Appl1	APN	14	26949476	missense	possibly damaging	0.89
IGL01615:Appl1	APN	14	26959470	splice site	probably benign
IGL01633:Appl1	APN	14	26962838	missense	probably damaging	0.99
IGL01945:Appl1	APN	14	26928655	missense	possibly damaging	0.80
IGL02210:Appl1	APN	14	26925952	splice site	probably benign
IGL02650:Appl1	APN	14	26950708	missense	possibly damaging	0.76
IGL02674:Appl1	APN	14	26949461	missense	possibly damaging	0.86
IGL02803:Appl1	APN	14	26951516	missense	possibly damaging	0.93
R0129:Appl1	UTSW	14	26928643	missense	probably damaging	1.00
R0183:Appl1	UTSW	14	26962854	missense	probably damaging	1.00
R0323:Appl1	UTSW	14	26942738	missense	possibly damaging	0.91
R0411:Appl1	UTSW	14	26940256	missense	probably benign
R1213:Appl1	UTSW	14	26943993	missense	probably benign	0.27
R1277:Appl1	UTSW	14	26927856	missense	possibly damaging	0.87
R1668:Appl1	UTSW	14	26923854	missense	probably damaging	1.00
R1856:Appl1	UTSW	14	26927749	missense	probably damaging	1.00
R1889:Appl1	UTSW	14	26925513	splice site	probably benign
R2145:Appl1	UTSW	14	26949619	missense	possibly damaging	0.66
R3720:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3722:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3917:Appl1	UTSW	14	26928604	missense	probably damaging	1.00
R4700:Appl1	UTSW	14	26925971	missense	probably benign	0.00
R5139:Appl1	UTSW	14	26947155	missense	probably benign	0.04
R5485:Appl1	UTSW	14	26962866	missense	probably damaging	1.00
R5536:Appl1	UTSW	14	26923780	nonsense	probably null
R5795:Appl1	UTSW	14	26942816	missense	probably benign	0.01
R7044:Appl1	UTSW	14	26928677	missense	possibly damaging	0.90
R7318:Appl1	UTSW	14	26963660	missense	probably benign	0.01
R7447:Appl1	UTSW	14	26959452	nonsense	probably null
R7943:Appl1	UTSW	14	26945568	missense	probably benign	0.01
R8110:Appl1	UTSW	14	26927794	nonsense	probably null
R8129:Appl1	UTSW	14	26949509	missense	possibly damaging	0.87
R8160:Appl1	UTSW	14	26928635	missense	probably benign	0.35
R8211:Appl1	UTSW	14	26945598	missense	probably benign	0.18
R8239:Appl1	UTSW	14	26964957	missense	probably damaging	0.99
R8379:Appl1	UTSW	14	26925415	critical splice donor site	probably null
R8464:Appl1	UTSW	14	26953028	nonsense	probably null
R9023:Appl1	UTSW	14	26963695	missense	possibly damaging	0.93
R9090:Appl1	UTSW	14	26947127	missense	probably benign	0.01
R9203:Appl1	UTSW	14	26961013	nonsense	probably null
R9227:Appl1	UTSW	14	26923735	missense	unknown
R9230:Appl1	UTSW	14	26923735	missense	unknown
R9243:Appl1	UTSW	14	26927753	missense	possibly damaging	0.62
R9271:Appl1	UTSW	14	26947127	missense	probably benign	0.01
R9378:Appl1	UTSW	14	26927827	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAAGTCAGATTAGGTTCTGGTTGC -3'
(R):5'- GTCATTAGCAGAGTGAGACATTCTAG -3'

Sequencing Primer
(F):5'- GAGCACTGACTGTTCTTCCAGAAG -3'
(R):5'- CAGAGTGAGACATTCTAGAGCTTTTC -3'

Posted On

2021-04-30