Incidental Mutation 'R8699:Crybg3'
ID668958
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59554928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 274 (Y274H)
Ref Sequence ENSEMBL: ENSMUSP00000037682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
Predicted Effect probably damaging
Transcript: ENSMUST00000044604
AA Change: Y274H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723
AA Change: Y274H

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172910
AA Change: Y1988H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 splice site probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense possibly damaging 0.77
R7133:Crybg3 UTSW 16 59536804 missense probably damaging 1.00
R7193:Crybg3 UTSW 16 59559593 missense possibly damaging 0.87
R7204:Crybg3 UTSW 16 59558890 missense probably benign 0.00
R7398:Crybg3 UTSW 16 59557325 missense probably benign 0.38
R7666:Crybg3 UTSW 16 59559337 nonsense probably null
R7691:Crybg3 UTSW 16 59556134 missense not run
R7714:Crybg3 UTSW 16 59558873 missense probably benign 0.19
R7860:Crybg3 UTSW 16 59555242 missense probably benign 0.04
R7901:Crybg3 UTSW 16 59557544 missense probably damaging 0.98
R8371:Crybg3 UTSW 16 59557051 missense probably benign 0.00
R8394:Crybg3 UTSW 16 59558288 missense probably benign 0.06
R8438:Crybg3 UTSW 16 59565292 missense probably benign 0.02
R8529:Crybg3 UTSW 16 59556621 missense probably damaging 0.98
R8766:Crybg3 UTSW 16 59555333 missense probably benign 0.05
R8767:Crybg3 UTSW 16 59556137 missense probably benign
R8789:Crybg3 UTSW 16 59554996 missense probably benign 0.00
R8871:Crybg3 UTSW 16 59558156 missense probably benign
R8878:Crybg3 UTSW 16 59560184 missense probably benign 0.09
R8894:Crybg3 UTSW 16 59522189 missense probably damaging 0.97
R8939:Crybg3 UTSW 16 59556149 missense probably benign 0.00
RF007:Crybg3 UTSW 16 59556704 missense possibly damaging 0.94
Z1177:Crybg3 UTSW 16 59555393 nonsense probably null
Z1177:Crybg3 UTSW 16 59556478 missense probably benign 0.09
Z1187:Crybg3 UTSW 16 59506245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCTCACCCAGTTTACC -3'
(R):5'- CTTGCTTCGCATTTCAGGGG -3'

Sequencing Primer
(F):5'- CTTCTTTTTCAAAATGATGGACCAGG -3'
(R):5'- GGCTATGAGTCGCCTACATTAAG -3'
Posted On2021-04-30