Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Abca3'

668961

Institutional Source

Beutler Lab

Gene Symbol

Abca3

Ensembl Gene

ENSMUSG00000024130

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 3

Synonyms

ABC-C, 1810036E22Rik, Abc3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24351950-24410201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24408225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1555 (D1555G)

Ref Sequence

ENSEMBL: ENSMUSP00000045285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]

AlphaFold

Q8R420

Predicted Effect

probably benign
Transcript: ENSMUST00000039013
AA Change: D1555G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: D1555G

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	2.1e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	1.8e-35	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079594
AA Change: D1555G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: D1555G

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	22	469	2.6e-28	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	5.5e-39	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117337
AA Change: D1300G

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: D1300G

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	1.3e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	761	1068	8.8e-29	PFAM
AAA	1153	1337	1.64e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Abca3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Abca3	APN	17	24374246	missense	probably damaging	1.00
IGL01538:Abca3	APN	17	24376473	missense	possibly damaging	0.64
IGL01633:Abca3	APN	17	24397353	nonsense	probably null
IGL01837:Abca3	APN	17	24408697	missense	probably damaging	1.00
IGL01986:Abca3	APN	17	24408114	missense	probably damaging	1.00
IGL02049:Abca3	APN	17	24376730	nonsense	probably null
IGL02186:Abca3	APN	17	24377740	missense	possibly damaging	0.95
IGL02794:Abca3	APN	17	24402411	missense	probably benign	0.05
IGL02962:Abca3	APN	17	24400409	missense	probably damaging	1.00
IGL02963:Abca3	APN	17	24384529	missense	probably damaging	1.00
IGL03118:Abca3	APN	17	24400450	missense	probably benign	0.17
IGL03144:Abca3	APN	17	24381964	missense	probably benign	0.37
R0028:Abca3	UTSW	17	24377724	missense	probably benign	0.39
R0278:Abca3	UTSW	17	24381920	missense	probably benign	0.09
R0570:Abca3	UTSW	17	24374399	missense	probably benign
R0825:Abca3	UTSW	17	24400577	missense	probably damaging	1.00
R1164:Abca3	UTSW	17	24402331	missense	probably damaging	1.00
R1348:Abca3	UTSW	17	24374238	splice site	probably null
R1557:Abca3	UTSW	17	24399980	missense	possibly damaging	0.46
R1661:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1665:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1754:Abca3	UTSW	17	24377779	missense	probably benign	0.00
R1828:Abca3	UTSW	17	24366197	missense	probably benign	0.34
R1834:Abca3	UTSW	17	24376692	missense	probably benign	0.00
R1996:Abca3	UTSW	17	24387532	missense	probably damaging	1.00
R2032:Abca3	UTSW	17	24366082	splice site	probably benign
R2100:Abca3	UTSW	17	24408209	missense	probably damaging	0.99
R2154:Abca3	UTSW	17	24377719	missense	probably damaging	1.00
R2240:Abca3	UTSW	17	24376443	missense	probably damaging	0.98
R2281:Abca3	UTSW	17	24376726	missense	possibly damaging	0.88
R2994:Abca3	UTSW	17	24384564	missense	probably damaging	1.00
R4091:Abca3	UTSW	17	24397482	missense	probably damaging	1.00
R4294:Abca3	UTSW	17	24400569	missense	possibly damaging	0.96
R4496:Abca3	UTSW	17	24383973	missense	possibly damaging	0.93
R4633:Abca3	UTSW	17	24387529	missense	probably null	1.00
R4866:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5022:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5023:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5072:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5073:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5074:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5123:Abca3	UTSW	17	24384460	missense	possibly damaging	0.95
R5157:Abca3	UTSW	17	24408122	missense	probably damaging	1.00
R5183:Abca3	UTSW	17	24374453	missense	probably benign	0.39
R5269:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R5566:Abca3	UTSW	17	24383927	missense	probably benign
R5579:Abca3	UTSW	17	24376729	missense	probably damaging	0.97
R5620:Abca3	UTSW	17	24396470	missense	probably benign	0.05
R5755:Abca3	UTSW	17	24398454	missense	probably damaging	1.00
R5954:Abca3	UTSW	17	24397416	missense	probably benign	0.00
R6041:Abca3	UTSW	17	24376380	missense	probably damaging	0.99
R6187:Abca3	UTSW	17	24408167	missense	possibly damaging	0.88
R6253:Abca3	UTSW	17	24397552	missense	probably benign	0.01
R6375:Abca3	UTSW	17	24387562	missense	possibly damaging	0.96
R6487:Abca3	UTSW	17	24397472	missense	possibly damaging	0.81
R6616:Abca3	UTSW	17	24384535	missense	probably damaging	1.00
R6632:Abca3	UTSW	17	24384470	missense	probably benign
R6781:Abca3	UTSW	17	24374406	missense	possibly damaging	0.95
R6918:Abca3	UTSW	17	24408658	missense	probably damaging	1.00
R6962:Abca3	UTSW	17	24364726	missense	probably benign	0.39
R7163:Abca3	UTSW	17	24364942	missense	probably benign
R7199:Abca3	UTSW	17	24377707	missense	probably damaging	1.00
R7287:Abca3	UTSW	17	24385887	missense	possibly damaging	0.91
R7303:Abca3	UTSW	17	24398521	missense	possibly damaging	0.83
R7338:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R7430:Abca3	UTSW	17	24364958	critical splice donor site	probably null
R7437:Abca3	UTSW	17	24400498	missense	probably damaging	0.99
R7776:Abca3	UTSW	17	24386276	missense	possibly damaging	0.77
R7805:Abca3	UTSW	17	24405154	critical splice donor site	probably null
R7811:Abca3	UTSW	17	24397388	missense	probably benign	0.00
R7848:Abca3	UTSW	17	24384532	missense	probably damaging	1.00
R7859:Abca3	UTSW	17	24384526	missense	probably damaging	1.00
R7877:Abca3	UTSW	17	24384023	nonsense	probably null
R7893:Abca3	UTSW	17	24385466	missense	probably damaging	1.00
R7910:Abca3	UTSW	17	24385853	missense	probably benign	0.09
R7911:Abca3	UTSW	17	24398504	missense	probably damaging	1.00
R7964:Abca3	UTSW	17	24402436	missense	probably benign	0.26
R8016:Abca3	UTSW	17	24364952	missense	probably benign	0.06
R8028:Abca3	UTSW	17	24407697	missense	probably benign	0.02
R8150:Abca3	UTSW	17	24396548	missense	probably benign	0.08
R8298:Abca3	UTSW	17	24385401	missense	probably damaging	1.00
R8444:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R8505:Abca3	UTSW	17	24374497	missense	probably damaging	0.97
R8547:Abca3	UTSW	17	24397500	missense	probably benign	0.00
R8903:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R9046:Abca3	UTSW	17	24398503	missense	probably damaging	1.00
R9136:Abca3	UTSW	17	24377833	missense	probably benign	0.01
R9236:Abca3	UTSW	17	24407738	missense	probably benign	0.16
R9331:Abca3	UTSW	17	24397350	missense	probably benign	0.00
R9585:Abca3	UTSW	17	24400512	missense	probably benign	0.12
R9602:Abca3	UTSW	17	24398404	missense	probably benign	0.35
R9714:Abca3	UTSW	17	24376728	missense	probably benign	0.44
X0018:Abca3	UTSW	17	24396480	missense	possibly damaging	0.63
Z1177:Abca3	UTSW	17	24408236	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGACTGGGAGCAAGAGTATTTG -3'
(R):5'- ACCAGGCCATTTCTGATTCC -3'

Sequencing Primer
(F):5'- GTATTAATTACTGACCTTGCCTCCTG -3'
(R):5'- TGATTCCCCGTGCTGAGAGTAAC -3'

Posted On

2021-04-30