Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Mdga1'

668962

Institutional Source

Beutler Lab

Gene Symbol

Mdga1

Ensembl Gene

ENSMUSG00000043557

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29827956-29970087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29842374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 548 (V548M)

Ref Sequence

ENSEMBL: ENSMUSP00000126529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]

AlphaFold

Q0PMG2

Predicted Effect

probably benign
Transcript: ENSMUST00000073556
AA Change: V548M

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: V548M

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	741	911	1.02e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167190
AA Change: V822M

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: V822M

Domain	Start	End	E-Value	Type
low complexity region	236	246	N/A	INTRINSIC
low complexity region	251	265	N/A	INTRINSIC
IGc2	325	389	1.62e-12	SMART
IG	416	510	3.2e-2	SMART
IGc2	527	589	6.25e-14	SMART
IGc2	622	696	3.54e-4	SMART
IGc2	728	795	6.55e-8	SMART
IGc2	825	897	9.49e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168044

SMART Domains

Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557

Domain	Start	End	E-Value	Type
Pfam:MAM	47	186	3.1e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171691
AA Change: V548M

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: V548M

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	749	919	3.61e-53	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Mdga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01576:Mdga1	APN	17	29843127	missense	possibly damaging	0.50
IGL01637:Mdga1	APN	17	29839871	missense	probably damaging	1.00
IGL02130:Mdga1	APN	17	29857669	missense	possibly damaging	0.96
IGL02596:Mdga1	APN	17	29832405	splice site	probably benign
IGL03258:Mdga1	APN	17	29839913	missense	probably damaging	1.00
R0184:Mdga1	UTSW	17	29852442	missense	probably damaging	1.00
R0366:Mdga1	UTSW	17	29857708	missense	possibly damaging	0.85
R1017:Mdga1	UTSW	17	29850548	missense	probably damaging	0.98
R1520:Mdga1	UTSW	17	29846519	missense	probably benign	0.12
R1545:Mdga1	UTSW	17	29842902	missense	probably damaging	1.00
R1549:Mdga1	UTSW	17	29837998	missense	probably damaging	1.00
R1671:Mdga1	UTSW	17	29850629	missense	probably damaging	1.00
R1875:Mdga1	UTSW	17	29852607	missense	probably damaging	1.00
R1893:Mdga1	UTSW	17	29849226	missense	probably damaging	1.00
R1958:Mdga1	UTSW	17	29840888	missense	probably damaging	1.00
R1983:Mdga1	UTSW	17	29850605	missense	probably damaging	1.00
R2014:Mdga1	UTSW	17	29849313	missense	probably damaging	1.00
R2894:Mdga1	UTSW	17	29852504	missense	probably damaging	1.00
R2964:Mdga1	UTSW	17	29852468	missense	probably damaging	1.00
R3813:Mdga1	UTSW	17	29838479	missense	probably damaging	1.00
R3938:Mdga1	UTSW	17	29857622	missense	probably damaging	1.00
R3982:Mdga1	UTSW	17	29931264	missense	unknown
R4063:Mdga1	UTSW	17	29838031	missense	probably damaging	1.00
R4157:Mdga1	UTSW	17	29833343	missense	probably benign	0.32
R4183:Mdga1	UTSW	17	29969990	missense	unknown
R4392:Mdga1	UTSW	17	29850656	missense	probably damaging	1.00
R4393:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4396:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4806:Mdga1	UTSW	17	29842154	missense	probably benign	0.20
R4829:Mdga1	UTSW	17	29846369	missense	possibly damaging	0.91
R4923:Mdga1	UTSW	17	29838078	missense	probably damaging	0.99
R4932:Mdga1	UTSW	17	29857606	missense	probably damaging	1.00
R5015:Mdga1	UTSW	17	29839873	missense	possibly damaging	0.71
R5076:Mdga1	UTSW	17	29850554	missense	possibly damaging	0.93
R5141:Mdga1	UTSW	17	29852493	missense	probably benign	0.43
R5180:Mdga1	UTSW	17	29857736	splice site	probably benign
R5590:Mdga1	UTSW	17	29839867	missense	probably damaging	1.00
R5747:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R5748:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R6207:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R6826:Mdga1	UTSW	17	29970026	missense	unknown
R6831:Mdga1	UTSW	17	29887516	nonsense	probably null
R7114:Mdga1	UTSW	17	29842842	splice site	probably null
R7147:Mdga1	UTSW	17	29846521	nonsense	probably null
R7273:Mdga1	UTSW	17	29969938	missense	unknown
R7413:Mdga1	UTSW	17	29850673	missense	probably damaging	1.00
R7637:Mdga1	UTSW	17	29832379	missense	probably benign	0.00
R7797:Mdga1	UTSW	17	29842840	splice site	probably null
R7812:Mdga1	UTSW	17	29843141	missense	probably benign	0.02
R7838:Mdga1	UTSW	17	29839822	missense	probably benign	0.10
R8463:Mdga1	UTSW	17	29849729	missense	probably damaging	1.00
R8697:Mdga1	UTSW	17	29846641	missense	probably damaging	0.97
R8864:Mdga1	UTSW	17	29931321	missense	unknown
R8945:Mdga1	UTSW	17	29839985	splice site	probably benign
R9150:Mdga1	UTSW	17	29838446	missense	probably damaging	0.98
R9157:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R9294:Mdga1	UTSW	17	29839897	missense	probably damaging	1.00
R9301:Mdga1	UTSW	17	29850538	missense	probably benign	0.31
R9367:Mdga1	UTSW	17	29832308	makesense	probably null
R9567:Mdga1	UTSW	17	29857595	missense	probably damaging	1.00
R9665:Mdga1	UTSW	17	29833017	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGACGCTGCACTCGTAGTTG -3'
(R):5'- CAGTCTAGGAAGGATGGCTG -3'

Sequencing Primer
(F):5'- GTAGTTGCCGCTGCTGTCAC -3'
(R):5'- TGAATGGCCCGCAGTCTGAG -3'

Posted On

2021-04-30