Incidental Mutation 'R8699:Mdga1'
ID 668962
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms Mamdc3, 1200011I03Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 30046930-30107557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30061348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 548 (V548M)
Ref Sequence ENSEMBL: ENSMUSP00000126529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]
AlphaFold Q0PMG2
Predicted Effect probably benign
Transcript: ENSMUST00000073556
AA Change: V548M

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: V548M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167190
AA Change: V822M

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: V822M

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168044
SMART Domains Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
Pfam:MAM 47 186 3.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171691
AA Change: V548M

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: V548M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 30,062,101 (GRCm39) missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 30,058,845 (GRCm39) missense probably damaging 1.00
IGL02130:Mdga1 APN 17 30,076,643 (GRCm39) missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 30,051,379 (GRCm39) splice site probably benign
IGL03258:Mdga1 APN 17 30,058,887 (GRCm39) missense probably damaging 1.00
R0184:Mdga1 UTSW 17 30,071,416 (GRCm39) missense probably damaging 1.00
R0366:Mdga1 UTSW 17 30,076,682 (GRCm39) missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 30,069,522 (GRCm39) missense probably damaging 0.98
R1520:Mdga1 UTSW 17 30,065,493 (GRCm39) missense probably benign 0.12
R1545:Mdga1 UTSW 17 30,061,876 (GRCm39) missense probably damaging 1.00
R1549:Mdga1 UTSW 17 30,056,972 (GRCm39) missense probably damaging 1.00
R1671:Mdga1 UTSW 17 30,069,603 (GRCm39) missense probably damaging 1.00
R1875:Mdga1 UTSW 17 30,071,581 (GRCm39) missense probably damaging 1.00
R1893:Mdga1 UTSW 17 30,068,200 (GRCm39) missense probably damaging 1.00
R1958:Mdga1 UTSW 17 30,059,862 (GRCm39) missense probably damaging 1.00
R1983:Mdga1 UTSW 17 30,069,579 (GRCm39) missense probably damaging 1.00
R2014:Mdga1 UTSW 17 30,068,287 (GRCm39) missense probably damaging 1.00
R2894:Mdga1 UTSW 17 30,071,478 (GRCm39) missense probably damaging 1.00
R2964:Mdga1 UTSW 17 30,071,442 (GRCm39) missense probably damaging 1.00
R3813:Mdga1 UTSW 17 30,057,453 (GRCm39) missense probably damaging 1.00
R3938:Mdga1 UTSW 17 30,076,596 (GRCm39) missense probably damaging 1.00
R3982:Mdga1 UTSW 17 30,150,238 (GRCm39) missense unknown
R4063:Mdga1 UTSW 17 30,057,005 (GRCm39) missense probably damaging 1.00
R4157:Mdga1 UTSW 17 30,052,317 (GRCm39) missense probably benign 0.32
R4183:Mdga1 UTSW 17 30,188,964 (GRCm39) missense unknown
R4392:Mdga1 UTSW 17 30,069,630 (GRCm39) missense probably damaging 1.00
R4393:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4396:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4806:Mdga1 UTSW 17 30,061,128 (GRCm39) missense probably benign 0.20
R4829:Mdga1 UTSW 17 30,065,343 (GRCm39) missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 30,057,052 (GRCm39) missense probably damaging 0.99
R4932:Mdga1 UTSW 17 30,076,580 (GRCm39) missense probably damaging 1.00
R5015:Mdga1 UTSW 17 30,058,847 (GRCm39) missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 30,069,528 (GRCm39) missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 30,071,467 (GRCm39) missense probably benign 0.43
R5180:Mdga1 UTSW 17 30,076,710 (GRCm39) splice site probably benign
R5590:Mdga1 UTSW 17 30,058,841 (GRCm39) missense probably damaging 1.00
R5747:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R5748:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R6207:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R6826:Mdga1 UTSW 17 30,189,000 (GRCm39) missense unknown
R6831:Mdga1 UTSW 17 30,106,490 (GRCm39) nonsense probably null
R7114:Mdga1 UTSW 17 30,061,816 (GRCm39) splice site probably null
R7147:Mdga1 UTSW 17 30,065,495 (GRCm39) nonsense probably null
R7273:Mdga1 UTSW 17 30,188,912 (GRCm39) missense unknown
R7413:Mdga1 UTSW 17 30,069,647 (GRCm39) missense probably damaging 1.00
R7637:Mdga1 UTSW 17 30,051,353 (GRCm39) missense probably benign 0.00
R7797:Mdga1 UTSW 17 30,061,814 (GRCm39) splice site probably null
R7812:Mdga1 UTSW 17 30,062,115 (GRCm39) missense probably benign 0.02
R7838:Mdga1 UTSW 17 30,058,796 (GRCm39) missense probably benign 0.10
R8463:Mdga1 UTSW 17 30,068,703 (GRCm39) missense probably damaging 1.00
R8697:Mdga1 UTSW 17 30,065,615 (GRCm39) missense probably damaging 0.97
R8864:Mdga1 UTSW 17 30,150,295 (GRCm39) missense unknown
R8945:Mdga1 UTSW 17 30,058,959 (GRCm39) splice site probably benign
R9150:Mdga1 UTSW 17 30,057,420 (GRCm39) missense probably damaging 0.98
R9157:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R9294:Mdga1 UTSW 17 30,058,871 (GRCm39) missense probably damaging 1.00
R9301:Mdga1 UTSW 17 30,069,512 (GRCm39) missense probably benign 0.31
R9367:Mdga1 UTSW 17 30,051,282 (GRCm39) makesense probably null
R9567:Mdga1 UTSW 17 30,076,569 (GRCm39) missense probably damaging 1.00
R9665:Mdga1 UTSW 17 30,051,991 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACGCTGCACTCGTAGTTG -3'
(R):5'- CAGTCTAGGAAGGATGGCTG -3'

Sequencing Primer
(F):5'- GTAGTTGCCGCTGCTGTCAC -3'
(R):5'- TGAATGGCCCGCAGTCTGAG -3'
Posted On 2021-04-30