Incidental Mutation 'R8699:Asxl3'
ID 668964
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Name ASXL transcriptional regulator 3
Synonyms D430002O22Rik, C230079D11Rik, LOC381127, D930044O18Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 22477303-22663284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22567664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000095260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000097655
AA Change: T81A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: T81A

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120223
AA Change: T81A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: T81A

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Pcdhgb6 A T 18: 37,875,975 (GRCm39) I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22,658,280 (GRCm39) missense probably benign 0.41
IGL00510:Asxl3 APN 18 22,656,622 (GRCm39) missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22,655,503 (GRCm39) missense probably benign 0.06
IGL01074:Asxl3 APN 18 22,655,902 (GRCm39) missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22,649,503 (GRCm39) missense probably benign 0.06
IGL01313:Asxl3 APN 18 22,650,516 (GRCm39) missense probably benign 0.41
IGL01349:Asxl3 APN 18 22,657,294 (GRCm39) missense probably benign 0.28
IGL01529:Asxl3 APN 18 22,650,712 (GRCm39) missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22,656,621 (GRCm39) missense probably benign 0.06
IGL01583:Asxl3 APN 18 22,649,654 (GRCm39) missense probably benign 0.01
IGL01619:Asxl3 APN 18 22,656,385 (GRCm39) missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22,658,382 (GRCm39) missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22,655,545 (GRCm39) missense probably benign 0.10
IGL01828:Asxl3 APN 18 22,658,615 (GRCm39) utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22,567,633 (GRCm39) missense probably benign 0.00
IGL01906:Asxl3 APN 18 22,655,338 (GRCm39) missense probably benign 0.01
IGL01962:Asxl3 APN 18 22,655,502 (GRCm39) missense probably benign 0.00
IGL01991:Asxl3 APN 18 22,649,219 (GRCm39) missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22,657,401 (GRCm39) missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22,658,035 (GRCm39) missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22,586,683 (GRCm39) missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22,655,510 (GRCm39) missense probably benign 0.01
IGL02478:Asxl3 APN 18 22,656,070 (GRCm39) missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22,585,456 (GRCm39) missense probably benign 0.19
IGL02660:Asxl3 APN 18 22,657,402 (GRCm39) missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22,657,718 (GRCm39) missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22,656,541 (GRCm39) missense probably benign 0.01
IGL03001:Asxl3 APN 18 22,650,455 (GRCm39) missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22,656,031 (GRCm39) missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22,649,503 (GRCm39) missense probably benign 0.06
BB001:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
BB011:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R0145:Asxl3 UTSW 18 22,586,662 (GRCm39) missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22,656,211 (GRCm39) missense probably benign
R0207:Asxl3 UTSW 18 22,544,553 (GRCm39) splice site probably benign
R0230:Asxl3 UTSW 18 22,585,383 (GRCm39) splice site probably benign
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22,650,668 (GRCm39) missense probably benign 0.00
R0519:Asxl3 UTSW 18 22,656,577 (GRCm39) missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22,656,043 (GRCm39) missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22,654,849 (GRCm39) splice site probably benign
R0626:Asxl3 UTSW 18 22,655,937 (GRCm39) missense probably benign 0.02
R0711:Asxl3 UTSW 18 22,657,508 (GRCm39) missense probably benign 0.01
R0744:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22,658,106 (GRCm39) missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22,657,564 (GRCm39) missense probably benign 0.00
R1372:Asxl3 UTSW 18 22,543,066 (GRCm39) missense probably benign 0.00
R1440:Asxl3 UTSW 18 22,658,281 (GRCm39) missense probably benign 0.13
R1463:Asxl3 UTSW 18 22,649,810 (GRCm39) missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22,649,411 (GRCm39) missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22,650,044 (GRCm39) missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22,585,492 (GRCm39) missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22,655,125 (GRCm39) missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22,650,796 (GRCm39) missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22,585,420 (GRCm39) missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22,656,508 (GRCm39) missense probably benign 0.02
R2174:Asxl3 UTSW 18 22,586,701 (GRCm39) missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22,649,652 (GRCm39) missense probably benign
R2443:Asxl3 UTSW 18 22,544,596 (GRCm39) missense probably benign 0.12
R2907:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22,658,557 (GRCm39) missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22,657,423 (GRCm39) missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22,657,290 (GRCm39) missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4661:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4674:Asxl3 UTSW 18 22,650,795 (GRCm39) missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22,649,826 (GRCm39) missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22,658,511 (GRCm39) missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22,656,369 (GRCm39) missense probably benign 0.06
R5062:Asxl3 UTSW 18 22,655,775 (GRCm39) missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22,649,076 (GRCm39) missense probably benign 0.00
R5065:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22,649,765 (GRCm39) missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22,656,172 (GRCm39) missense probably benign 0.45
R5183:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22,649,496 (GRCm39) missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22,657,551 (GRCm39) missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22,658,304 (GRCm39) missense probably benign 0.28
R5873:Asxl3 UTSW 18 22,649,142 (GRCm39) missense probably benign 0.04
R6240:Asxl3 UTSW 18 22,598,565 (GRCm39) missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22,655,839 (GRCm39) missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22,649,397 (GRCm39) missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22,650,134 (GRCm39) nonsense probably null
R6704:Asxl3 UTSW 18 22,650,362 (GRCm39) missense probably benign 0.00
R6706:Asxl3 UTSW 18 22,586,666 (GRCm39) missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22,658,497 (GRCm39) missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22,598,457 (GRCm39) nonsense probably null
R6811:Asxl3 UTSW 18 22,655,968 (GRCm39) missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22,656,637 (GRCm39) missense probably benign 0.00
R6830:Asxl3 UTSW 18 22,658,445 (GRCm39) missense probably benign 0.45
R6957:Asxl3 UTSW 18 22,655,148 (GRCm39) missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22,656,978 (GRCm39) missense probably benign 0.00
R7058:Asxl3 UTSW 18 22,650,731 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,759 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,758 (GRCm39) nonsense probably null
R7231:Asxl3 UTSW 18 22,650,597 (GRCm39) missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22,544,556 (GRCm39) critical splice acceptor site probably null
R7431:Asxl3 UTSW 18 22,650,010 (GRCm39) missense probably damaging 1.00
R7851:Asxl3 UTSW 18 22,650,279 (GRCm39) missense possibly damaging 0.62
R7871:Asxl3 UTSW 18 22,657,281 (GRCm39) missense not run
R7880:Asxl3 UTSW 18 22,655,208 (GRCm39) missense possibly damaging 0.90
R7924:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R8061:Asxl3 UTSW 18 22,657,300 (GRCm39) missense possibly damaging 0.62
R8115:Asxl3 UTSW 18 22,650,642 (GRCm39) missense probably damaging 0.99
R8174:Asxl3 UTSW 18 22,650,800 (GRCm39) missense probably benign 0.02
R8303:Asxl3 UTSW 18 22,657,473 (GRCm39) missense probably benign
R8360:Asxl3 UTSW 18 22,649,174 (GRCm39) missense probably benign
R8547:Asxl3 UTSW 18 22,655,829 (GRCm39) missense probably benign 0.04
R8774:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8774-TAIL:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8867:Asxl3 UTSW 18 22,649,547 (GRCm39) missense possibly damaging 0.87
R8915:Asxl3 UTSW 18 22,657,763 (GRCm39) missense probably benign 0.00
R8954:Asxl3 UTSW 18 22,650,807 (GRCm39) missense probably damaging 1.00
R9031:Asxl3 UTSW 18 22,657,401 (GRCm39) missense probably damaging 0.96
R9047:Asxl3 UTSW 18 22,585,471 (GRCm39) missense probably damaging 1.00
R9047:Asxl3 UTSW 18 22,585,465 (GRCm39) missense probably damaging 1.00
R9135:Asxl3 UTSW 18 22,657,481 (GRCm39) missense possibly damaging 0.89
R9135:Asxl3 UTSW 18 22,649,670 (GRCm39) missense probably damaging 0.99
R9210:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9212:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9285:Asxl3 UTSW 18 22,654,989 (GRCm39) missense probably damaging 1.00
R9572:Asxl3 UTSW 18 22,649,112 (GRCm39) missense probably benign 0.25
R9707:Asxl3 UTSW 18 22,656,304 (GRCm39) missense probably benign 0.01
R9768:Asxl3 UTSW 18 22,650,101 (GRCm39) missense probably benign 0.00
R9784:Asxl3 UTSW 18 22,650,311 (GRCm39) missense probably benign
Z1088:Asxl3 UTSW 18 22,649,829 (GRCm39) missense probably benign 0.00
Z1176:Asxl3 UTSW 18 22,655,277 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,656,648 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,649,396 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGAATCCAGATATGCTTCCGC -3'
(R):5'- CAGAGTTCTCAGTTTAATTCTTGCC -3'

Sequencing Primer
(F):5'- TGCTTCCGCACACTGTG -3'
(R):5'- ACCCTTAACCTTCTGTAGG -3'
Posted On 2021-04-30