Incidental Mutation 'R8699:Pcdha1'
ID668965
Institutional Source Beutler Lab
Gene Symbol Pcdha1
Ensembl Gene ENSMUSG00000103442
Gene Nameprotocadherin alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8699 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36930184-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36931023 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 247 (I247F)
Ref Sequence ENSEMBL: ENSMUSP00000068828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000193839]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
AA Change: I247F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442
AA Change: I247F

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193839
AA Change: I247F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442
AA Change: I247F

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rest G A 5: 77,281,542 G603R probably benign Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Pcdha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdha1 APN 18 36932175 missense probably damaging 0.99
R0062:Pcdha1 UTSW 18 37006628 missense probably benign 0.08
R0108:Pcdha1 UTSW 18 36998756 missense probably benign
R0543:Pcdha1 UTSW 18 37185068 missense probably damaging 1.00
R1599:Pcdha1 UTSW 18 37185237 missense probably damaging 1.00
R1717:Pcdha1 UTSW 18 36932184 missense probably benign 0.01
R2301:Pcdha1 UTSW 18 37156183 missense probably damaging 1.00
R3038:Pcdha1 UTSW 18 36931011 missense probably damaging 1.00
R3086:Pcdha1 UTSW 18 36930948 missense possibly damaging 0.95
R3693:Pcdha1 UTSW 18 36932308 missense possibly damaging 0.95
R3783:Pcdha1 UTSW 18 36930802 missense probably damaging 1.00
R3881:Pcdha1 UTSW 18 36931401 missense possibly damaging 0.91
R4012:Pcdha1 UTSW 18 36931136 missense probably benign 0.02
R4540:Pcdha1 UTSW 18 36931627 missense probably damaging 1.00
R4597:Pcdha1 UTSW 18 36931906 missense possibly damaging 0.64
R4678:Pcdha1 UTSW 18 36930912 missense probably benign 0.00
R4998:Pcdha1 UTSW 18 36932416 missense probably damaging 1.00
R5466:Pcdha1 UTSW 18 36932259 missense possibly damaging 0.73
R5518:Pcdha1 UTSW 18 36932362 missense probably benign 0.23
R5673:Pcdha1 UTSW 18 36930673 missense probably damaging 1.00
R5925:Pcdha1 UTSW 18 36930671 missense probably damaging 1.00
R5942:Pcdha1 UTSW 18 36930391 missense probably damaging 1.00
R5963:Pcdha1 UTSW 18 36931171 missense probably damaging 0.99
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6107:Pcdha1 UTSW 18 36932301 missense probably benign 0.00
R6329:Pcdha1 UTSW 18 36932248 missense probably damaging 1.00
R6479:Pcdha1 UTSW 18 36931456 missense probably benign 0.28
R6503:Pcdha1 UTSW 18 36931671 missense probably damaging 1.00
R6907:Pcdha1 UTSW 18 36931071 missense probably benign 0.01
R7011:Pcdha1 UTSW 18 36930535 missense probably damaging 1.00
R7030:Pcdha1 UTSW 18 37159273 missense probably damaging 0.97
R7314:Pcdha1 UTSW 18 36931500 missense probably damaging 0.99
R7343:Pcdha1 UTSW 18 36930649 missense probably damaging 1.00
R7699:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7700:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7768:Pcdha1 UTSW 18 36932167 missense probably damaging 1.00
R7780:Pcdha1 UTSW 18 36932458 missense probably benign 0.28
R7800:Pcdha1 UTSW 18 36931373 missense probably damaging 1.00
R7917:Pcdha1 UTSW 18 36932201 missense possibly damaging 0.64
R8325:Pcdha1 UTSW 18 36930814 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTAAATCCCTTTCGCTTGAACTG -3'
(R):5'- GGAGTCCCTTTATCAACTGCC -3'

Sequencing Primer
(F):5'- CCCTTTCGCTTGAACTGAGAAAATC -3'
(R):5'- CCGATCACTCTAATTTCTCCTGAAAG -3'
Posted On2021-04-30