Incidental Mutation 'R8699:Pcdhgb6'
ID 668966
Institutional Source Beutler Lab
Gene Symbol Pcdhgb6
Ensembl Gene ENSMUSG00000103088
Gene Name protocadherin gamma subfamily B, 6
Synonyms
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37875147-37974926 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37875975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 228 (I228L)
Ref Sequence ENSEMBL: ENSMUSP00000003599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195823]
AlphaFold Q91XX4
Predicted Effect probably benign
Transcript: ENSMUST00000003599
AA Change: I228L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088
AA Change: I228L

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,450,515 (GRCm39) W30R probably damaging Het
Abca3 A G 17: 24,627,199 (GRCm39) D1555G probably benign Het
Anapc1 T C 2: 128,483,373 (GRCm39) T1241A probably damaging Het
Ano5 G A 7: 51,243,519 (GRCm39) V881I probably benign Het
Appl1 G A 14: 26,662,212 (GRCm39) S490L probably benign Het
Asxl3 A G 18: 22,567,664 (GRCm39) T81A probably benign Het
Bclaf1 T C 10: 20,209,184 (GRCm39) S754P possibly damaging Het
Bicra G T 7: 15,723,113 (GRCm39) Q135K probably benign Het
Cad T C 5: 31,233,605 (GRCm39) V1951A possibly damaging Het
Cadm3 T A 1: 173,168,683 (GRCm39) Y295F probably damaging Het
Ccnt1 A G 15: 98,462,995 (GRCm39) I59T probably damaging Het
Ccr6 C T 17: 8,475,398 (GRCm39) T201M probably benign Het
Cd5 A G 19: 10,702,556 (GRCm39) F209S possibly damaging Het
Cep126 A C 9: 8,087,362 (GRCm39) D1017E probably damaging Het
Cfap298 T C 16: 90,727,945 (GRCm39) K82E probably benign Het
Cntnap4 A T 8: 113,484,228 (GRCm39) D427V probably damaging Het
Col4a4 T A 1: 82,433,455 (GRCm39) N1496I unknown Het
Crybg3 A G 16: 59,375,291 (GRCm39) Y274H probably damaging Het
Cubn C A 2: 13,388,770 (GRCm39) S1479I probably damaging Het
Diras2 A T 13: 52,662,143 (GRCm39) C55S probably damaging Het
Dleu7 G A 14: 62,530,279 (GRCm39) R41C probably benign Het
Dync2i1 T C 12: 116,171,321 (GRCm39) T972A probably benign Het
Efcab3 A G 11: 104,672,072 (GRCm39) T1464A probably benign Het
Exo5 A G 4: 120,779,193 (GRCm39) I224T probably damaging Het
Fcho1 T C 8: 72,162,277 (GRCm39) I774V possibly damaging Het
Gclm T G 3: 122,059,972 (GRCm39) S251A possibly damaging Het
Gm13889 T C 2: 93,787,327 (GRCm39) Q49R unknown Het
Gm35315 T A 5: 110,228,392 (GRCm39) H18L probably benign Het
Gm9949 G A 18: 62,317,043 (GRCm39) G65R unknown Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gria4 C A 9: 4,424,347 (GRCm39) K839N probably damaging Het
Gria4 T G 9: 4,424,351 (GRCm39) Y838S probably damaging Het
Hrh3 A G 2: 179,743,149 (GRCm39) W160R probably damaging Het
Htr4 G A 18: 62,570,763 (GRCm39) A273T probably damaging Het
Lig3 G T 11: 82,685,376 (GRCm39) C599F probably damaging Het
Lrp1b A T 2: 41,172,207 (GRCm39) V1594E Het
Map3k10 A T 7: 27,367,780 (GRCm39) V286D probably damaging Het
Map4k4 T A 1: 40,015,910 (GRCm39) V117E unknown Het
Mdga1 C T 17: 30,061,348 (GRCm39) V548M possibly damaging Het
Mms22l A T 4: 24,507,363 (GRCm39) L248F possibly damaging Het
Ncaph T C 2: 126,963,096 (GRCm39) D379G possibly damaging Het
Neb A G 2: 52,037,246 (GRCm39) V7064A probably benign Het
Neb G A 2: 52,102,563 (GRCm39) T4570M probably benign Het
Npy5r G T 8: 67,134,274 (GRCm39) T173K probably damaging Het
Or52a33 A T 7: 103,288,822 (GRCm39) I175N probably damaging Het
Or5b94 A G 19: 12,652,246 (GRCm39) M226V probably benign Het
Or5b97 A T 19: 12,878,828 (GRCm39) F105L possibly damaging Het
Or5g25 A T 2: 85,478,330 (GRCm39) C112S possibly damaging Het
Or8u10 A T 2: 85,915,518 (GRCm39) I201N probably damaging Het
Oxsm A G 14: 16,242,631 (GRCm38) I46T possibly damaging Het
Pcdha1 A T 18: 37,064,076 (GRCm39) I247F probably benign Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Ppp1r9a A G 6: 5,115,474 (GRCm39) S866G probably benign Het
Ppp6r3 T A 19: 3,546,587 (GRCm39) S304C probably damaging Het
Pramel11 A T 4: 143,623,762 (GRCm39) N137K probably benign Het
Ptprd A T 4: 75,959,629 (GRCm39) F279I probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rest G A 5: 77,429,389 (GRCm39) G603R probably benign Het
Rgs17 A T 10: 5,868,194 (GRCm39) L9M probably benign Het
Rtp1 A G 16: 23,250,133 (GRCm39) Y166C probably damaging Het
Sec24b C A 3: 129,798,653 (GRCm39) R572I probably damaging Het
Setd1a G T 7: 127,385,774 (GRCm39) R827L possibly damaging Het
Sh3tc1 T C 5: 35,859,235 (GRCm39) Y1091C probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stat4 T A 1: 52,111,096 (GRCm39) M181K probably benign Het
Stk16 A G 1: 75,188,682 (GRCm39) E67G probably benign Het
Supv3l1 A G 10: 62,268,234 (GRCm39) V537A possibly damaging Het
Tmc8 A G 11: 117,674,361 (GRCm39) E101G possibly damaging Het
Tmem106a A T 11: 101,473,120 (GRCm39) probably benign Het
Tpr T A 1: 150,293,772 (GRCm39) I922N probably damaging Het
Uaca G T 9: 60,778,347 (GRCm39) L911F probably damaging Het
Ubn1 A T 16: 4,881,567 (GRCm39) I200L possibly damaging Het
Ush2a A G 1: 188,643,574 (GRCm39) D4312G probably damaging Het
Virma A T 4: 11,528,678 (GRCm39) Y1255F probably benign Het
Vmn1r170 C T 7: 23,306,080 (GRCm39) Q161* probably null Het
Vmn1r175 G T 7: 23,508,234 (GRCm39) A131D probably benign Het
Vmn1r52 T A 6: 90,155,742 (GRCm39) N15K probably benign Het
Wdr46 T A 17: 34,167,826 (GRCm39) I513N probably damaging Het
Zfp788 A G 7: 41,297,840 (GRCm39) N159D probably benign Het
Other mutations in Pcdhgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Pcdhgb6 APN 18 37,876,758 (GRCm39) missense probably damaging 1.00
R4459:Pcdhgb6 UTSW 18 37,875,759 (GRCm39) missense probably benign 0.00
R4921:Pcdhgb6 UTSW 18 37,876,525 (GRCm39) missense probably damaging 1.00
R5019:Pcdhgb6 UTSW 18 37,875,994 (GRCm39) missense probably damaging 1.00
R5391:Pcdhgb6 UTSW 18 37,875,640 (GRCm39) missense probably damaging 0.97
R5828:Pcdhgb6 UTSW 18 37,877,457 (GRCm39) missense probably benign 0.00
R6056:Pcdhgb6 UTSW 18 37,876,165 (GRCm39) missense probably benign 0.01
R6242:Pcdhgb6 UTSW 18 37,876,608 (GRCm39) missense probably benign 0.00
R6375:Pcdhgb6 UTSW 18 37,875,678 (GRCm39) missense probably damaging 0.97
R6836:Pcdhgb6 UTSW 18 37,876,015 (GRCm39) missense probably benign 0.11
R6973:Pcdhgb6 UTSW 18 37,875,526 (GRCm39) missense possibly damaging 0.64
R7185:Pcdhgb6 UTSW 18 37,876,701 (GRCm39) missense probably benign 0.42
R7994:Pcdhgb6 UTSW 18 37,875,724 (GRCm39) missense probably damaging 1.00
R8095:Pcdhgb6 UTSW 18 37,875,924 (GRCm39) missense probably benign 0.00
R8460:Pcdhgb6 UTSW 18 37,877,278 (GRCm39) missense possibly damaging 0.88
R8558:Pcdhgb6 UTSW 18 37,877,237 (GRCm39) missense probably damaging 1.00
R8808:Pcdhgb6 UTSW 18 37,876,451 (GRCm39) missense possibly damaging 0.88
R9350:Pcdhgb6 UTSW 18 37,876,872 (GRCm39) missense probably benign 0.00
R9668:Pcdhgb6 UTSW 18 37,875,561 (GRCm39) missense probably benign 0.02
R9707:Pcdhgb6 UTSW 18 37,876,768 (GRCm39) missense possibly damaging 0.49
R9765:Pcdhgb6 UTSW 18 37,876,054 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCCCGACATAAATTTGAATTCGG -3'
(R):5'- AGAACACGTGTCTTGTGCTCTG -3'

Sequencing Primer
(F):5'- CGGTTAAAGATTACCAGATAAGCTCC -3'
(R):5'- GCGCAGTGCTCCGAAAGTAG -3'
Posted On 2021-04-30