Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Htr4'

668968

Institutional Source

Beutler Lab

Gene Symbol

Htr4

Ensembl Gene

ENSMUSG00000026322

Gene Name

5 hydroxytryptamine (serotonin) receptor 4

Synonyms

5-HT4, 5-HT<4L>

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62324204-62467802 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62437692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 273 (A273T)

Ref Sequence

ENSEMBL: ENSMUSP00000027560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027560]

AlphaFold

P97288

Predicted Effect

probably damaging
Transcript: ENSMUST00000027560
AA Change: A273T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027560
Gene: ENSMUSG00000026322
AA Change: A273T

Domain	Start	End	E-Value	Type
Pfam:7tm_1	36	312	7e-68	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice exhibit attenuated feeding behavior following stress and novelty and show a hypersensitivity to seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Htr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01965:Htr4	APN	18	62437669	missense	probably damaging	1.00
IGL02822:Htr4	APN	18	62428184	splice site	probably benign
IGL03240:Htr4	APN	18	62437621	missense	possibly damaging	0.92
P0042:Htr4	UTSW	18	62413677	missense	probably damaging	1.00
R0485:Htr4	UTSW	18	62428154	missense	probably damaging	1.00
R1137:Htr4	UTSW	18	62437553	missense	probably damaging	1.00
R1661:Htr4	UTSW	18	62412234	missense	probably damaging	0.97
R1665:Htr4	UTSW	18	62412234	missense	probably damaging	0.97
R1682:Htr4	UTSW	18	62428066	missense	possibly damaging	0.91
R1903:Htr4	UTSW	18	62428122	missense	probably benign	0.01
R2215:Htr4	UTSW	18	62413716	nonsense	probably null
R2847:Htr4	UTSW	18	62428126	missense	probably damaging	1.00
R2848:Htr4	UTSW	18	62428126	missense	probably damaging	1.00
R5764:Htr4	UTSW	18	62437542	missense	probably damaging	0.97
R5787:Htr4	UTSW	18	62413622	missense	probably damaging	0.98
R7184:Htr4	UTSW	18	62437427	nonsense	probably null
R7278:Htr4	UTSW	18	62412176	missense	probably benign	0.04
R7811:Htr4	UTSW	18	62412198	missense	possibly damaging	0.51
R8190:Htr4	UTSW	18	62437900	missense	possibly damaging	0.64
R8312:Htr4	UTSW	18	62437478	missense	probably damaging	1.00
R8725:Htr4	UTSW	18	62428138	missense	probably damaging	1.00
R8727:Htr4	UTSW	18	62428138	missense	probably damaging	1.00
R8757:Htr4	UTSW	18	62412264	missense	probably damaging	1.00
R8787:Htr4	UTSW	18	62437782	missense	possibly damaging	0.87
Z1177:Htr4	UTSW	18	62437608	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TGTGGTGGCCTTCTACATCC -3'
(R):5'- TAGCGCTCATCATCACAGC -3'

Sequencing Primer
(F):5'- ATGGTGCTGGCCTATTACCGAATC -3'
(R):5'- GCTCATCATCACAGCAGAGG -3'

Posted On

2021-04-30