Incidental Mutation 'R8700:Abtb2'
ID 668977
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB (POZ) domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8700 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 103566310-103718423 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103566944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 73 (T73K)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably damaging
Transcript: ENSMUST00000076212
AA Change: T73K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T73K

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,292,025 I1717N possibly damaging Het
4933414I15Rik T A 11: 50,942,517 D86V unknown Het
Akr1c14 T C 13: 4,081,157 probably benign Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ano7 T G 1: 93,388,607 I204S probably damaging Het
Arhgef39 T A 4: 43,496,715 Q333L probably benign Het
Art5 T C 7: 102,099,655 probably benign Het
Asah1 T C 8: 41,360,275 T34A probably benign Het
Atp9b T C 18: 80,753,146 E894G Het
Atxn7l3 A T 11: 102,293,921 M126K possibly damaging Het
Cacna2d4 A G 6: 119,281,693 D580G probably damaging Het
Calcoco2 T A 11: 96,103,504 K74N probably benign Het
Ccdc163 T C 4: 116,714,151 probably null Het
Cep164 T C 9: 45,775,369 probably null Het
Chd7 T A 4: 8,833,892 N1215K probably damaging Het
Chsy3 T C 18: 59,176,415 Y247H probably damaging Het
Clec16a A G 16: 10,688,558 Y714C probably damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
D430042O09Rik A G 7: 125,829,870 probably benign Het
Daam2 T A 17: 49,496,152 K77N probably damaging Het
Dhx35 T A 2: 158,840,632 M495K possibly damaging Het
Disp2 T A 2: 118,789,859 C357* probably null Het
Dnah6 T A 6: 73,075,890 probably benign Het
Dnah7a T G 1: 53,495,929 D2724A possibly damaging Het
Entpd5 A T 12: 84,396,734 D53E probably damaging Het
Fto T A 8: 91,522,833 I431N probably damaging Het
Gabrr2 T C 4: 33,095,488 I459T probably damaging Het
Gm5565 T A 5: 146,160,426 I29F probably damaging Het
Gm9195 C T 14: 72,482,731 G87R probably damaging Het
Grin2a T C 16: 9,579,548 S892G probably benign Het
Mki67 T C 7: 135,705,707 N106S Het
Myo16 T C 8: 10,413,172 S580P unknown Het
Neo1 A G 9: 58,918,630 S672P probably benign Het
Nxph3 A T 11: 95,510,880 V236E probably damaging Het
Olfr1406 G T 1: 173,183,862 P191T probably benign Het
Olfr863-ps1 A C 9: 19,941,700 L247V unknown Het
Pcdhb14 T C 18: 37,449,599 V586A probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pja2 C T 17: 64,292,954 D512N probably damaging Het
Ppfibp2 A G 7: 107,746,395 T875A possibly damaging Het
Ppp3cc C A 14: 70,236,552 C332F probably damaging Het
Pramef25 T A 4: 143,949,131 H375L possibly damaging Het
Psg18 A T 7: 18,353,625 V36D probably damaging Het
Ptprh A G 7: 4,564,191 S561P probably damaging Het
Rhbdf2 G A 11: 116,607,404 probably benign Het
Ripk2 T A 4: 16,158,422 N61I possibly damaging Het
Setdb2 T C 14: 59,417,439 Y318C probably damaging Het
Shc1 A G 3: 89,427,433 D533G possibly damaging Het
Sirpb1a T C 3: 15,411,359 E193G probably damaging Het
Slc41a2 T C 10: 83,316,233 E126G probably damaging Het
Srms C A 2: 181,206,728 A413S probably damaging Het
Tob2 G T 15: 81,851,601 R56S probably damaging Het
Unc119 T C 11: 78,347,311 I105T probably benign Het
Unc13c T C 9: 73,572,397 I1742V probably benign Het
Vmn1r46 C T 6: 89,976,343 T58I probably benign Het
Vmn2r81 G T 10: 79,293,683 V803F probably damaging Het
Zfp365 T C 10: 67,909,705 K81R possibly damaging Het
Zfp974 G T 7: 27,910,047 T751K possibly damaging Het
Zfpl1 T C 19: 6,082,434 N149S probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103717192 nonsense probably null
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7629:Abtb2 UTSW 2 103683493 critical splice donor site probably null
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
R8682:Abtb2 UTSW 2 103567375 missense probably benign 0.36
R9164:Abtb2 UTSW 2 103711484 missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103683302 missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103711235 missense probably benign 0.00
R9258:Abtb2 UTSW 2 103716065 missense probably null 0.99
R9343:Abtb2 UTSW 2 103717160 missense probably benign
R9427:Abtb2 UTSW 2 103700899 missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103708187 missense probably benign
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTTGACCTTGGACTCC -3'
(R):5'- TCATGCTGTAGAGGGACAACG -3'

Sequencing Primer
(F):5'- ACCTTGGACTCCGGGTATG -3'
(R):5'- CTGTAGAGGGACAACGCCTTG -3'
Posted On 2021-04-30