Incidental Mutation 'R8700:Sirpb1a'
ID 668981
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission 068554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8700 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15476419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 193 (E193G)
Ref Sequence ENSEMBL: ENSMUSP00000141504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
AlphaFold A0A0A6YYP6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099201
AA Change: E193G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: E193G

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192700
AA Change: E193G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: E193G

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194144
AA Change: E126G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: E126G

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik T A 11: 50,833,344 (GRCm39) D86V unknown Het
Abtb2 C A 2: 103,397,289 (GRCm39) T73K probably damaging Het
Akr1c14 T C 13: 4,131,157 (GRCm39) probably benign Het
Anapc7 T A 5: 122,560,669 (GRCm39) M10K probably damaging Het
Ano7 T G 1: 93,316,329 (GRCm39) I204S probably damaging Het
Arhgef39 T A 4: 43,496,715 (GRCm39) Q333L probably benign Het
Art5 T C 7: 101,748,862 (GRCm39) probably benign Het
Asah1 T C 8: 41,813,312 (GRCm39) T34A probably benign Het
Atp9b T C 18: 80,796,361 (GRCm39) E894G Het
Atxn7l3 A T 11: 102,184,747 (GRCm39) M126K possibly damaging Het
Cacna2d4 A G 6: 119,258,654 (GRCm39) D580G probably damaging Het
Calcoco2 T A 11: 95,994,330 (GRCm39) K74N probably benign Het
Ccdc163 T C 4: 116,571,348 (GRCm39) probably null Het
Cep164 T C 9: 45,686,667 (GRCm39) probably null Het
Chd7 T A 4: 8,833,892 (GRCm39) N1215K probably damaging Het
Chsy3 T C 18: 59,309,487 (GRCm39) Y247H probably damaging Het
Clec16a A G 16: 10,506,422 (GRCm39) Y714C probably damaging Het
Col12a1 A G 9: 79,527,371 (GRCm39) V2653A probably benign Het
Daam2 T A 17: 49,803,180 (GRCm39) K77N probably damaging Het
Dhx35 T A 2: 158,682,552 (GRCm39) M495K possibly damaging Het
Disp2 T A 2: 118,620,340 (GRCm39) C357* probably null Het
Dnah6 T A 6: 73,052,873 (GRCm39) probably benign Het
Dnah7a T G 1: 53,535,088 (GRCm39) D2724A possibly damaging Het
Entpd5 A T 12: 84,443,508 (GRCm39) D53E probably damaging Het
Fto T A 8: 92,249,461 (GRCm39) I431N probably damaging Het
Gabrr2 T C 4: 33,095,488 (GRCm39) I459T probably damaging Het
Gm5565 T A 5: 146,097,236 (GRCm39) I29F probably damaging Het
Gm9195 C T 14: 72,720,171 (GRCm39) G87R probably damaging Het
Grin2a T C 16: 9,397,412 (GRCm39) S892G probably benign Het
Katnip A G 7: 125,429,042 (GRCm39) probably benign Het
Mki67 T C 7: 135,307,436 (GRCm39) N106S Het
Myo16 T C 8: 10,463,172 (GRCm39) S580P unknown Het
Neo1 A G 9: 58,825,913 (GRCm39) S672P probably benign Het
Nxph3 A T 11: 95,401,706 (GRCm39) V236E probably damaging Het
Or10j7 G T 1: 173,011,429 (GRCm39) P191T probably benign Het
Or7e171-ps1 A C 9: 19,852,996 (GRCm39) L247V unknown Het
Pcdhb14 T C 18: 37,582,652 (GRCm39) V586A probably damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Pja2 C T 17: 64,599,949 (GRCm39) D512N probably damaging Het
Ppfibp2 A G 7: 107,345,602 (GRCm39) T875A possibly damaging Het
Ppp3cc C A 14: 70,474,001 (GRCm39) C332F probably damaging Het
Pramel16 T A 4: 143,675,701 (GRCm39) H375L possibly damaging Het
Psg18 A T 7: 18,087,550 (GRCm39) V36D probably damaging Het
Ptprh A G 7: 4,567,190 (GRCm39) S561P probably damaging Het
Rhbdf2 G A 11: 116,498,230 (GRCm39) probably benign Het
Ripk2 T A 4: 16,158,422 (GRCm39) N61I possibly damaging Het
Setdb2 T C 14: 59,654,888 (GRCm39) Y318C probably damaging Het
Shc1 A G 3: 89,334,740 (GRCm39) D533G possibly damaging Het
Slc41a2 T C 10: 83,152,097 (GRCm39) E126G probably damaging Het
Spata31h1 A T 10: 82,127,859 (GRCm39) I1717N possibly damaging Het
Srms C A 2: 180,848,521 (GRCm39) A413S probably damaging Het
Tob2 G T 15: 81,735,802 (GRCm39) R56S probably damaging Het
Unc119 T C 11: 78,238,137 (GRCm39) I105T probably benign Het
Unc13c T C 9: 73,479,679 (GRCm39) I1742V probably benign Het
Vmn1r46 C T 6: 89,953,325 (GRCm39) T58I probably benign Het
Vmn2r81 G T 10: 79,129,517 (GRCm39) V803F probably damaging Het
Zfp365 T C 10: 67,745,535 (GRCm39) K81R possibly damaging Het
Zfp974 G T 7: 27,609,472 (GRCm39) T751K possibly damaging Het
Zfpl1 T C 19: 6,132,464 (GRCm39) N149S probably benign Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R6223:Sirpb1a UTSW 3 15,444,086 (GRCm39) missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15,481,984 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R9263:Sirpb1a UTSW 3 15,481,992 (GRCm39) missense probably damaging 1.00
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGAGCTAGGATTCAGAAACATC -3'
(R):5'- ATGTCATCAGTGGTGGCTATC -3'

Sequencing Primer
(F):5'- GCTAGGATTCAGAAACATCTACCTTG -3'
(R):5'- GTCATCAGTGGTGGCTATCAAAATG -3'
Posted On 2021-04-30