Incidental Mutation 'R8700:Psg18'
ID 668995
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8700 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18353625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 36 (V36D)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably damaging
Transcript: ENSMUST00000003597
AA Change: V36D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: V36D

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098783
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,292,025 I1717N possibly damaging Het
4933414I15Rik T A 11: 50,942,517 D86V unknown Het
Abtb2 C A 2: 103,566,944 T73K probably damaging Het
Akr1c14 T C 13: 4,081,157 probably benign Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ano7 T G 1: 93,388,607 I204S probably damaging Het
Arhgef39 T A 4: 43,496,715 Q333L probably benign Het
Art5 T C 7: 102,099,655 probably benign Het
Asah1 T C 8: 41,360,275 T34A probably benign Het
Atp9b T C 18: 80,753,146 E894G Het
Atxn7l3 A T 11: 102,293,921 M126K possibly damaging Het
Cacna2d4 A G 6: 119,281,693 D580G probably damaging Het
Calcoco2 T A 11: 96,103,504 K74N probably benign Het
Ccdc163 T C 4: 116,714,151 probably null Het
Cep164 T C 9: 45,775,369 probably null Het
Chd7 T A 4: 8,833,892 N1215K probably damaging Het
Chsy3 T C 18: 59,176,415 Y247H probably damaging Het
Clec16a A G 16: 10,688,558 Y714C probably damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
D430042O09Rik A G 7: 125,829,870 probably benign Het
Daam2 T A 17: 49,496,152 K77N probably damaging Het
Dhx35 T A 2: 158,840,632 M495K possibly damaging Het
Disp2 T A 2: 118,789,859 C357* probably null Het
Dnah6 T A 6: 73,075,890 probably benign Het
Dnah7a T G 1: 53,495,929 D2724A possibly damaging Het
Entpd5 A T 12: 84,396,734 D53E probably damaging Het
Fto T A 8: 91,522,833 I431N probably damaging Het
Gabrr2 T C 4: 33,095,488 I459T probably damaging Het
Gm5565 T A 5: 146,160,426 I29F probably damaging Het
Gm9195 C T 14: 72,482,731 G87R probably damaging Het
Grin2a T C 16: 9,579,548 S892G probably benign Het
Mki67 T C 7: 135,705,707 N106S Het
Myo16 T C 8: 10,413,172 S580P unknown Het
Neo1 A G 9: 58,918,630 S672P probably benign Het
Nxph3 A T 11: 95,510,880 V236E probably damaging Het
Olfr1406 G T 1: 173,183,862 P191T probably benign Het
Olfr863-ps1 A C 9: 19,941,700 L247V unknown Het
Pcdhb14 T C 18: 37,449,599 V586A probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pja2 C T 17: 64,292,954 D512N probably damaging Het
Ppfibp2 A G 7: 107,746,395 T875A possibly damaging Het
Ppp3cc C A 14: 70,236,552 C332F probably damaging Het
Pramef25 T A 4: 143,949,131 H375L possibly damaging Het
Ptprh A G 7: 4,564,191 S561P probably damaging Het
Rhbdf2 G A 11: 116,607,404 probably benign Het
Ripk2 T A 4: 16,158,422 N61I possibly damaging Het
Setdb2 T C 14: 59,417,439 Y318C probably damaging Het
Shc1 A G 3: 89,427,433 D533G possibly damaging Het
Sirpb1a T C 3: 15,411,359 E193G probably damaging Het
Slc41a2 T C 10: 83,316,233 E126G probably damaging Het
Srms C A 2: 181,206,728 A413S probably damaging Het
Tob2 G T 15: 81,851,601 R56S probably damaging Het
Unc119 T C 11: 78,347,311 I105T probably benign Het
Unc13c T C 9: 73,572,397 I1742V probably benign Het
Vmn1r46 C T 6: 89,976,343 T58I probably benign Het
Vmn2r81 G T 10: 79,293,683 V803F probably damaging Het
Zfp365 T C 10: 67,909,705 K81R possibly damaging Het
Zfp974 G T 7: 27,910,047 T751K possibly damaging Het
Zfpl1 T C 19: 6,082,434 N149S probably benign Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGACATTTTGGATCCACAGGG -3'
(R):5'- CTGAAGCTCTGAGGTCATGGAG -3'

Sequencing Primer
(F):5'- CAGGGACCCGTTGATGTATAATATC -3'
(R):5'- CATGGAGGTTATGTTGCTCATCTCC -3'
Posted On 2021-04-30