Incidental Mutation 'R8700:Slc41a2'
ID 669010
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Name solute carrier family 41, member 2
Synonyms A230035L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock # R8700 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83230848-83337882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83316233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 126 (E126G)
Ref Sequence ENSEMBL: ENSMUSP00000036690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956] [ENSMUST00000126617] [ENSMUST00000154730] [ENSMUST00000154926]
AlphaFold Q8BYR8
Predicted Effect probably damaging
Transcript: ENSMUST00000039956
AA Change: E126G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591
AA Change: E126G

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126617
Predicted Effect probably benign
Transcript: ENSMUST00000154730
Predicted Effect probably damaging
Transcript: ENSMUST00000154926
AA Change: E126G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,292,025 I1717N possibly damaging Het
4933414I15Rik T A 11: 50,942,517 D86V unknown Het
Abtb2 C A 2: 103,566,944 T73K probably damaging Het
Akr1c14 T C 13: 4,081,157 probably benign Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ano7 T G 1: 93,388,607 I204S probably damaging Het
Arhgef39 T A 4: 43,496,715 Q333L probably benign Het
Art5 T C 7: 102,099,655 probably benign Het
Asah1 T C 8: 41,360,275 T34A probably benign Het
Atp9b T C 18: 80,753,146 E894G Het
Atxn7l3 A T 11: 102,293,921 M126K possibly damaging Het
Cacna2d4 A G 6: 119,281,693 D580G probably damaging Het
Calcoco2 T A 11: 96,103,504 K74N probably benign Het
Ccdc163 T C 4: 116,714,151 probably null Het
Cep164 T C 9: 45,775,369 probably null Het
Chd7 T A 4: 8,833,892 N1215K probably damaging Het
Chsy3 T C 18: 59,176,415 Y247H probably damaging Het
Clec16a A G 16: 10,688,558 Y714C probably damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
D430042O09Rik A G 7: 125,829,870 probably benign Het
Daam2 T A 17: 49,496,152 K77N probably damaging Het
Dhx35 T A 2: 158,840,632 M495K possibly damaging Het
Disp2 T A 2: 118,789,859 C357* probably null Het
Dnah6 T A 6: 73,075,890 probably benign Het
Dnah7a T G 1: 53,495,929 D2724A possibly damaging Het
Entpd5 A T 12: 84,396,734 D53E probably damaging Het
Fto T A 8: 91,522,833 I431N probably damaging Het
Gabrr2 T C 4: 33,095,488 I459T probably damaging Het
Gm5565 T A 5: 146,160,426 I29F probably damaging Het
Gm9195 C T 14: 72,482,731 G87R probably damaging Het
Grin2a T C 16: 9,579,548 S892G probably benign Het
Mki67 T C 7: 135,705,707 N106S Het
Myo16 T C 8: 10,413,172 S580P unknown Het
Neo1 A G 9: 58,918,630 S672P probably benign Het
Nxph3 A T 11: 95,510,880 V236E probably damaging Het
Olfr1406 G T 1: 173,183,862 P191T probably benign Het
Olfr863-ps1 A C 9: 19,941,700 L247V unknown Het
Pcdhb14 T C 18: 37,449,599 V586A probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pja2 C T 17: 64,292,954 D512N probably damaging Het
Ppfibp2 A G 7: 107,746,395 T875A possibly damaging Het
Ppp3cc C A 14: 70,236,552 C332F probably damaging Het
Pramef25 T A 4: 143,949,131 H375L possibly damaging Het
Psg18 A T 7: 18,353,625 V36D probably damaging Het
Ptprh A G 7: 4,564,191 S561P probably damaging Het
Rhbdf2 G A 11: 116,607,404 probably benign Het
Ripk2 T A 4: 16,158,422 N61I possibly damaging Het
Setdb2 T C 14: 59,417,439 Y318C probably damaging Het
Shc1 A G 3: 89,427,433 D533G possibly damaging Het
Sirpb1a T C 3: 15,411,359 E193G probably damaging Het
Srms C A 2: 181,206,728 A413S probably damaging Het
Tob2 G T 15: 81,851,601 R56S probably damaging Het
Unc119 T C 11: 78,347,311 I105T probably benign Het
Unc13c T C 9: 73,572,397 I1742V probably benign Het
Vmn1r46 C T 6: 89,976,343 T58I probably benign Het
Vmn2r81 G T 10: 79,293,683 V803F probably damaging Het
Zfp365 T C 10: 67,909,705 K81R possibly damaging Het
Zfp974 G T 7: 27,910,047 T751K possibly damaging Het
Zfpl1 T C 19: 6,082,434 N149S probably benign Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R1875:Slc41a2 UTSW 10 83256085 missense probably damaging 1.00
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4193:Slc41a2 UTSW 10 83301221 missense probably damaging 0.97
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5140:Slc41a2 UTSW 10 83297291 missense probably damaging 0.98
R5189:Slc41a2 UTSW 10 83313411 splice site probably null
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
R7752:Slc41a2 UTSW 10 83256041 missense possibly damaging 0.73
R8289:Slc41a2 UTSW 10 83301180 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGCACTATGTCCAAAACCATG -3'
(R):5'- CATGGTGCCAGTCATTTACCAG -3'

Sequencing Primer
(F):5'- TGCCAGCAGAAACCGTTC -3'
(R):5'- GGTGCCAGTCATTTACCAGAAAAATC -3'
Posted On 2021-04-30