Incidental Mutation 'R8700:Setdb2'
ID669019
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R8700 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59417439 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 318 (Y318C)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: Y334C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: Y334C

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: Y318C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: Y318C

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,292,025 I1717N possibly damaging Het
4933414I15Rik T A 11: 50,942,517 D86V unknown Het
Abtb2 C A 2: 103,566,944 T73K probably damaging Het
Akr1c14 T C 13: 4,081,157 probably benign Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ano7 T G 1: 93,388,607 I204S probably damaging Het
Arhgef39 T A 4: 43,496,715 Q333L probably benign Het
Asah1 T C 8: 41,360,275 T34A probably benign Het
Atp9b T C 18: 80,753,146 E894G Het
Atxn7l3 A T 11: 102,293,921 M126K possibly damaging Het
Cacna2d4 A G 6: 119,281,693 D580G probably damaging Het
Calcoco2 T A 11: 96,103,504 K74N probably benign Het
Ccdc163 T C 4: 116,714,151 probably null Het
Cep164 T C 9: 45,775,369 probably null Het
Chd7 T A 4: 8,833,892 N1215K probably damaging Het
Chsy3 T C 18: 59,176,415 Y247H probably damaging Het
Clec16a A G 16: 10,688,558 Y714C probably damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Daam2 T A 17: 49,496,152 K77N probably damaging Het
Dhx35 T A 2: 158,840,632 M495K possibly damaging Het
Disp2 T A 2: 118,789,859 C357* probably null Het
Dnah7a T G 1: 53,495,929 D2724A possibly damaging Het
Entpd5 A T 12: 84,396,734 D53E probably damaging Het
Fto T A 8: 91,522,833 I431N probably damaging Het
Gabrr2 T C 4: 33,095,488 I459T probably damaging Het
Gm5565 T A 5: 146,160,426 I29F probably damaging Het
Gm9195 C T 14: 72,482,731 G87R probably damaging Het
Grin2a T C 16: 9,579,548 S892G probably benign Het
Mki67 T C 7: 135,705,707 N106S Het
Myo16 T C 8: 10,413,172 S580P unknown Het
Neo1 A G 9: 58,918,630 S672P probably benign Het
Nxph3 A T 11: 95,510,880 V236E probably damaging Het
Olfr1406 G T 1: 173,183,862 P191T probably benign Het
Olfr863-ps1 A C 9: 19,941,700 L247V unknown Het
Pcdhb14 T C 18: 37,449,599 V586A probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pja2 C T 17: 64,292,954 D512N probably damaging Het
Ppfibp2 A G 7: 107,746,395 T875A possibly damaging Het
Ppp3cc C A 14: 70,236,552 C332F probably damaging Het
Pramef25 T A 4: 143,949,131 H375L possibly damaging Het
Psg18 A T 7: 18,353,625 V36D probably damaging Het
Ptprh A G 7: 4,564,191 S561P probably damaging Het
Rhbdf2 G A 11: 116,607,404 probably benign Het
Ripk2 T A 4: 16,158,422 N61I possibly damaging Het
Shc1 A G 3: 89,427,433 D533G possibly damaging Het
Sirpb1a T C 3: 15,411,359 E193G probably damaging Het
Slc41a2 T C 10: 83,316,233 E126G probably damaging Het
Srms C A 2: 181,206,728 A413S probably damaging Het
Tob2 G T 15: 81,851,601 R56S probably damaging Het
Unc119 T C 11: 78,347,311 I105T probably benign Het
Unc13c T C 9: 73,572,397 I1742V probably benign Het
Vmn1r46 C T 6: 89,976,343 T58I probably benign Het
Vmn2r81 G T 10: 79,293,683 V803F probably damaging Het
Zfp365 T C 10: 67,909,705 K81R possibly damaging Het
Zfp974 G T 7: 27,910,047 T751K possibly damaging Het
Zfpl1 T C 19: 6,082,434 N149S probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8513:Setdb2 UTSW 14 59402390 missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59423458 nonsense probably null
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAACCTGTAAGACTGTAGACC -3'
(R):5'- TATAGTCCTTGAGCAAAACCTCTC -3'

Sequencing Primer
(F):5'- TGGAGCTCACATGTAGCTCTAGC -3'
(R):5'- GTTGACAGCAAAGAATGCC -3'
Posted On2021-04-30