Incidental Mutation 'R8701:4931408C20Rik'
ID 669031
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene Name RIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 26681814-26687460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26685445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 218 (V218D)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
AlphaFold E9PWP9
Predicted Effect probably benign
Transcript: ENSMUST00000097801
AA Change: V218D

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: V218D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Adamtsl4 T A 3: 95,684,966 D24V possibly damaging Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cd209c C T 8: 3,945,892 R6H probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dlg5 G A 14: 24,176,700 T378M probably benign Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Il18rap A G 1: 40,539,341 E304G probably benign Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
R7726:4931408C20Rik UTSW 1 26684498 missense probably benign 0.08
R8258:4931408C20Rik UTSW 1 26682481 missense probably benign 0.28
R8259:4931408C20Rik UTSW 1 26682481 missense probably benign 0.28
R8905:4931408C20Rik UTSW 1 26682814 missense probably damaging 0.97
R9137:4931408C20Rik UTSW 1 26685634 missense probably benign 0.13
R9138:4931408C20Rik UTSW 1 26682172 missense possibly damaging 0.90
R9170:4931408C20Rik UTSW 1 26684404 missense possibly damaging 0.93
R9287:4931408C20Rik UTSW 1 26683345 missense possibly damaging 0.51
R9331:4931408C20Rik UTSW 1 26683709 missense probably benign 0.00
R9535:4931408C20Rik UTSW 1 26682151 nonsense probably null
R9719:4931408C20Rik UTSW 1 26683739 missense probably benign 0.02
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTAATGGCTGCTTGACAATTTTGG -3'
(R):5'- TCCTCTGTGATCTCTGAGGCAG -3'

Sequencing Primer
(F):5'- GGCTGCTTGACAATTTTGGACATTAC -3'
(R):5'- CTGTGATCTCTGAGGCAGTTGTG -3'
Posted On 2021-04-30