Incidental Mutation 'R8701:Il18rap'
ID 669032
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Name interleukin 18 receptor accessory protein
Synonyms AcPL accessory protein-like)
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 40515362-40551705 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40539341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 304 (E304G)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
AlphaFold Q9Z2B1
Predicted Effect probably benign
Transcript: ENSMUST00000027237
AA Change: E304G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: E304G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,445 V218D probably benign Het
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Adamtsl4 T A 3: 95,684,966 D24V possibly damaging Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cd209c C T 8: 3,945,892 R6H probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dlg5 G A 14: 24,176,700 T378M probably benign Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
BB006:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB007:Il18rap UTSW 1 40548643 missense probably damaging 0.99
BB016:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB017:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0830:Il18rap UTSW 1 40542990 missense probably damaging 1.00
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R3721:Il18rap UTSW 1 40537088 missense probably damaging 1.00
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R5825:Il18rap UTSW 1 40531566 missense probably benign 0.38
R6140:Il18rap UTSW 1 40525052 missense probably benign 0.04
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
R7929:Il18rap UTSW 1 40531580 missense probably damaging 1.00
R7930:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R8151:Il18rap UTSW 1 40525268 missense probably benign 0.00
R8201:Il18rap UTSW 1 40539269 missense possibly damaging 0.75
R8356:Il18rap UTSW 1 40524924 missense probably benign 0.28
R8870:Il18rap UTSW 1 40525120 splice site probably benign
R8874:Il18rap UTSW 1 40525346 missense probably damaging 1.00
R8911:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8912:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8913:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8914:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8958:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8959:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9024:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9135:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9136:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9137:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9138:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9194:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9197:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9198:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9200:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9201:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9218:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9353:Il18rap UTSW 1 40547928 missense probably benign 0.02
R9465:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9466:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9535:Il18rap UTSW 1 40547830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATGTTCTGATACGCTCACC -3'
(R):5'- ATGAGAAATGGAGTGCCTCTG -3'

Sequencing Primer
(F):5'- AATGTTCTGATACGCTCACCTCCTG -3'
(R):5'- TGATAGATGGATGGATGGATAGATAG -3'
Posted On 2021-04-30