Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Nup210l'

669043

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90122814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 278 (M278T)

Ref Sequence

ENSEMBL: ENSMUSP00000029548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: M278T

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: M278T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: M278T

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: M278T

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,445	V218D	probably benign	Het
Abcc4	T	C	14: 118,599,373	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,684,966	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,316,092	F117I	probably damaging	Het
Aldh3b2	A	G	19: 3,978,448	E116G	probably damaging	Het
Alox5	T	A	6: 116,413,826	I455F	possibly damaging	Het
Arnt	C	T	3: 95,493,765	S675F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,007,141	Y456*	probably null	Het
Camkv	A	G	9: 107,948,041	T414A	possibly damaging	Het
Cd209c	C	T	8: 3,945,892	R6H	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,121,573	K183M	possibly damaging	Het
Dact3	G	T	7: 16,885,276	R232L	probably damaging	Het
Dlg5	G	A	14: 24,176,700	T378M	probably benign	Het
Dnah10	T	A	5: 124,726,847	D79E	probably benign	Het
Dsc1	A	T	18: 20,107,682	Y195*	probably null	Het
Elovl1	A	T	4: 118,430,510	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283	M155T	probably damaging	Het
Gm28308	C	G	6: 52,163,450		probably benign	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gtf2ird2	T	A	5: 134,216,235	I445N	probably damaging	Het
Gzmb	A	T	14: 56,260,360	V141E	probably benign	Het
Hmcn1	A	T	1: 150,755,257	M930K	probably benign	Het
Hunk	T	A	16: 90,386,610	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,539,341	E304G	probably benign	Het
Klk14	A	G	7: 43,694,142	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,095,153	S695P	probably damaging	Het
Mccc1	A	T	3: 35,995,784	D86E	probably benign	Het
Mcu	T	A	10: 59,467,653	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,107,191	F90S	possibly damaging	Het
Muc2	A	G	7: 141,695,607	D536G	probably damaging	Het
Naa11	T	C	5: 97,391,958	S114G	possibly damaging	Het
Ncaph	T	C	2: 127,106,138	K676E	probably benign	Het
Neurl2	C	T	2: 164,833,134	D103N	probably benign	Het
Olfr1192-ps1	A	G	2: 88,652,487	I112V	possibly damaging	Het
Olfr550	A	T	7: 102,578,692	M66L	possibly damaging	Het
Olfr897-ps1	A	T	9: 38,309,438	L214F	unknown	Het
Olfr967	A	T	9: 39,750,914	H176L	probably damaging	Het
Olfr981	A	G	9: 40,022,519	N42S	probably damaging	Het
Pcdh20	A	T	14: 88,468,413	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,574,683	Y3598C	probably damaging	Het
Plcg2	T	A	8: 117,581,677	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,830,642	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615	C625Y	probably damaging	Het
Ptcd3	T	C	6: 71,885,511	D480G	possibly damaging	Het
Rbm39	T	A	2: 156,161,587	K291M	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf220	T	C	4: 117,489,993	H74R	probably damaging	Het
Sp6	A	T	11: 97,022,264	T268S	probably damaging	Het
Sphk2	A	T	7: 45,710,825	V585E	probably damaging	Het
Syne1	G	A	10: 5,205,026	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,861,046	V573I	probably benign	Het
Tdrd1	T	C	19: 56,851,484	S659P	possibly damaging	Het
Tead4	T	A	6: 128,242,566	K237N	probably damaging	Het
Tex24	T	A	8: 27,345,124	C227S	probably benign	Het
Tom1	A	T	8: 75,052,168	T174S	probably benign	Het
Tpm3	C	T	3: 90,087,680	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,278,936	E111G	possibly damaging	Het
Unc80	A	G	1: 66,638,032	D2040G	possibly damaging	Het
Usp47	A	G	7: 112,093,195	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,047,690	A590V	probably damaging	Het
Wisp2	G	T	2: 163,828,866	G98W	probably damaging	Het
Zfp112	A	G	7: 24,125,740	R382G	probably damaging	Het
Zfp606	T	A	7: 12,481,098	D84E	unknown	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGAGCTTTGATGATTTCTTGCC -3'
(R):5'- GAACACAAGTGCCCTGTCTG -3'

Sequencing Primer
(F):5'- GATTTCTTGCCTATTTTTCTTTCCC -3'
(R):5'- GTCGCTAGCTGAGTGCACTATATC -3'

Posted On

2021-04-30