Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Arnt'

669044

Institutional Source

Beutler Lab

Gene Symbol

Arnt

Ensembl Gene

ENSMUSG00000015522

Gene Name

aryl hydrocarbon receptor nuclear translocator

Synonyms

ESTM42, Hif1b, D3Ertd557e, bHLHe2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95434388-95497240 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 95493765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 675 (S675F)

Ref Sequence

ENSEMBL: ENSMUSP00000099810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107161]

AlphaFold

P53762

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015666
AA Change: S655F

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522
AA Change: S655F

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
HLH	69	128	2.9e-11	SMART
PAS	143	210	7.4e-13	SMART
low complexity region	231	242	N/A	INTRINSIC
PAS	332	397	7.6e-10	SMART
PAC	404	447	9.6e-7	SMART
low complexity region	705	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090804
AA Change: S660F

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522
AA Change: S660F

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
HLH	80	133	1e-14	SMART
PAS	148	215	1.51e-10	SMART
low complexity region	236	247	N/A	INTRINSIC
PAS	337	402	1.55e-7	SMART
PAC	409	452	1.95e-4	SMART
low complexity region	710	723	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102749
AA Change: S675F

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522
AA Change: S675F

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
HLH	95	148	1e-14	SMART
PAS	163	230	1.51e-10	SMART
low complexity region	251	262	N/A	INTRINSIC
PAS	352	417	1.55e-7	SMART
PAC	424	467	1.95e-4	SMART
low complexity region	725	738	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107161
AA Change: S659F

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522
AA Change: S659F

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
HLH	80	133	1e-14	SMART
PAS	148	215	1.51e-10	SMART
low complexity region	236	247	N/A	INTRINSIC
PAS	337	402	1.55e-7	SMART
PAC	409	452	1.95e-4	SMART
low complexity region	694	707	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,445	V218D	probably benign	Het
Abcc4	T	C	14: 118,599,373	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,684,966	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,316,092	F117I	probably damaging	Het
Aldh3b2	A	G	19: 3,978,448	E116G	probably damaging	Het
Alox5	T	A	6: 116,413,826	I455F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,007,141	Y456*	probably null	Het
Camkv	A	G	9: 107,948,041	T414A	possibly damaging	Het
Cd209c	C	T	8: 3,945,892	R6H	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,121,573	K183M	possibly damaging	Het
Dact3	G	T	7: 16,885,276	R232L	probably damaging	Het
Dlg5	G	A	14: 24,176,700	T378M	probably benign	Het
Dnah10	T	A	5: 124,726,847	D79E	probably benign	Het
Dsc1	A	T	18: 20,107,682	Y195*	probably null	Het
Elovl1	A	T	4: 118,430,510	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283	M155T	probably damaging	Het
Gm28308	C	G	6: 52,163,450		probably benign	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gtf2ird2	T	A	5: 134,216,235	I445N	probably damaging	Het
Gzmb	A	T	14: 56,260,360	V141E	probably benign	Het
Hmcn1	A	T	1: 150,755,257	M930K	probably benign	Het
Hunk	T	A	16: 90,386,610	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,539,341	E304G	probably benign	Het
Klk14	A	G	7: 43,694,142	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,095,153	S695P	probably damaging	Het
Mccc1	A	T	3: 35,995,784	D86E	probably benign	Het
Mcu	T	A	10: 59,467,653	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,107,191	F90S	possibly damaging	Het
Muc2	A	G	7: 141,695,607	D536G	probably damaging	Het
Naa11	T	C	5: 97,391,958	S114G	possibly damaging	Het
Ncaph	T	C	2: 127,106,138	K676E	probably benign	Het
Neurl2	C	T	2: 164,833,134	D103N	probably benign	Het
Nup210l	T	C	3: 90,122,814	M278T	probably benign	Het
Olfr1192-ps1	A	G	2: 88,652,487	I112V	possibly damaging	Het
Olfr550	A	T	7: 102,578,692	M66L	possibly damaging	Het
Olfr897-ps1	A	T	9: 38,309,438	L214F	unknown	Het
Olfr967	A	T	9: 39,750,914	H176L	probably damaging	Het
Olfr981	A	G	9: 40,022,519	N42S	probably damaging	Het
Pcdh20	A	T	14: 88,468,413	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,574,683	Y3598C	probably damaging	Het
Plcg2	T	A	8: 117,581,677	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,830,642	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615	C625Y	probably damaging	Het
Ptcd3	T	C	6: 71,885,511	D480G	possibly damaging	Het
Rbm39	T	A	2: 156,161,587	K291M	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf220	T	C	4: 117,489,993	H74R	probably damaging	Het
Sp6	A	T	11: 97,022,264	T268S	probably damaging	Het
Sphk2	A	T	7: 45,710,825	V585E	probably damaging	Het
Syne1	G	A	10: 5,205,026	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,861,046	V573I	probably benign	Het
Tdrd1	T	C	19: 56,851,484	S659P	possibly damaging	Het
Tead4	T	A	6: 128,242,566	K237N	probably damaging	Het
Tex24	T	A	8: 27,345,124	C227S	probably benign	Het
Tom1	A	T	8: 75,052,168	T174S	probably benign	Het
Tpm3	C	T	3: 90,087,680	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,278,936	E111G	possibly damaging	Het
Unc80	A	G	1: 66,638,032	D2040G	possibly damaging	Het
Usp47	A	G	7: 112,093,195	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,047,690	A590V	probably damaging	Het
Wisp2	G	T	2: 163,828,866	G98W	probably damaging	Het
Zfp112	A	G	7: 24,125,740	R382G	probably damaging	Het
Zfp606	T	A	7: 12,481,098	D84E	unknown	Het

Other mutations in Arnt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Arnt	APN	3	95490340	missense	probably damaging	0.98
IGL00949:Arnt	APN	3	95487268	missense	probably damaging	1.00
IGL01304:Arnt	APN	3	95448385	missense	probably damaging	1.00
IGL01634:Arnt	APN	3	95470398	splice site	probably benign
IGL01685:Arnt	APN	3	95474681	missense	probably damaging	1.00
IGL01768:Arnt	APN	3	95491016	unclassified	probably benign
IGL02738:Arnt	APN	3	95495320	splice site	probably null
IGL02941:Arnt	APN	3	95460370	splice site	probably benign
R0211:Arnt	UTSW	3	95476149	missense	probably damaging	1.00
R0211:Arnt	UTSW	3	95476149	missense	probably damaging	1.00
R0420:Arnt	UTSW	3	95470394	splice site	probably benign
R0801:Arnt	UTSW	3	95493846	missense	possibly damaging	0.86
R1418:Arnt	UTSW	3	95470399	splice site	probably benign
R1523:Arnt	UTSW	3	95489654	missense	possibly damaging	0.77
R1956:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R1957:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R1958:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R1969:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R1970:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R1971:Arnt	UTSW	3	95448393	missense	possibly damaging	0.94
R3743:Arnt	UTSW	3	95474705	missense	possibly damaging	0.49
R4561:Arnt	UTSW	3	95452613	missense	probably damaging	0.96
R4780:Arnt	UTSW	3	95488385	missense	probably damaging	1.00
R4827:Arnt	UTSW	3	95489913	splice site	probably null
R4913:Arnt	UTSW	3	95490654	missense	probably damaging	1.00
R5051:Arnt	UTSW	3	95470337	missense	probably benign	0.08
R5572:Arnt	UTSW	3	95474704	missense	possibly damaging	0.49
R5866:Arnt	UTSW	3	95490726	unclassified	probably benign
R6376:Arnt	UTSW	3	95490625	missense	probably damaging	0.99
R6491:Arnt	UTSW	3	95476143	missense	probably damaging	1.00
R6873:Arnt	UTSW	3	95474575	missense	probably damaging	1.00
R6920:Arnt	UTSW	3	95490621	missense	probably damaging	0.99
R7485:Arnt	UTSW	3	95495348	missense	probably damaging	1.00
R7731:Arnt	UTSW	3	95483775	missense	probably benign	0.33
R7786:Arnt	UTSW	3	95484956	missense	probably damaging	0.96
R7797:Arnt	UTSW	3	95480261	critical splice donor site	probably null
R7947:Arnt	UTSW	3	95474526	splice site	probably null
R8143:Arnt	UTSW	3	95469983	splice site	probably null
R8446:Arnt	UTSW	3	95474703	frame shift	probably null
R8859:Arnt	UTSW	3	95490380	critical splice donor site	probably null
R9096:Arnt	UTSW	3	95490277	missense	probably benign	0.01
R9097:Arnt	UTSW	3	95490277	missense	probably benign	0.01
R9244:Arnt	UTSW	3	95490568	missense	possibly damaging	0.74
R9322:Arnt	UTSW	3	95490618	missense	probably benign	0.30
R9386:Arnt	UTSW	3	95488376	missense	possibly damaging	0.75
R9481:Arnt	UTSW	3	95483781	missense	possibly damaging	0.94
R9542:Arnt	UTSW	3	95490643	missense	probably benign	0.01
X0020:Arnt	UTSW	3	95494565	missense	probably benign	0.10
X0026:Arnt	UTSW	3	95474630	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACATTAGAAGCAGGTAATGGGTTG -3'
(R):5'- AGACCTGGACCATGCATTTC -3'

Sequencing Primer
(F):5'- AATGGGTTGGGTTTGGAAGAAG -3'
(R):5'- TAATTCGGTCAGCACATGCAG -3'

Posted On

2021-04-30