Incidental Mutation 'R8701:Adamtsl4'
ID 669045
Institutional Source Beutler Lab
Gene Symbol Adamtsl4
Ensembl Gene ENSMUSG00000015850
Gene Name ADAMTS-like 4
Synonyms Tsrc1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 95676201-95687917 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95684966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 24 (D24V)
Ref Sequence ENSEMBL: ENSMUSP00000015994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015994] [ENSMUST00000117782] [ENSMUST00000148854]
AlphaFold Q80T21
Predicted Effect possibly damaging
Transcript: ENSMUST00000015994
AA Change: D24V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015994
Gene: ENSMUSG00000015850
AA Change: D24V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3.9e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 995 1025 4.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117782
AA Change: D24V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113424
Gene: ENSMUSG00000015850
AA Change: D24V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 994 1026 3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148854
AA Change: D24V

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120844
Gene: ENSMUSG00000015850
AA Change: D24V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:TSP1 51 70 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ADAMTS superfamily of secreted proteins, which contain a metalloprotease domain at the N-terminus and a C-terminal ancillary domain. ADAMTS-like proteins lack protease activity and resemble the ancillary domain of ADAMTS proteins. ADAMTS-like proteins have been implicated in regulation of the extracellular matrix. The encoded protein contains 7 thrombospondin type 1 repeats, a conserved extracellular domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,445 V218D probably benign Het
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cd209c C T 8: 3,945,892 R6H probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dlg5 G A 14: 24,176,700 T378M probably benign Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Il18rap A G 1: 40,539,341 E304G probably benign Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in Adamtsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl4 APN 3 95677533 missense probably benign 0.22
IGL01685:Adamtsl4 APN 3 95684595 missense possibly damaging 0.93
IGL01707:Adamtsl4 APN 3 95683991 missense probably benign 0.39
IGL02105:Adamtsl4 APN 3 95680064 missense probably damaging 1.00
IGL02545:Adamtsl4 APN 3 95683374 nonsense probably null
IGL03089:Adamtsl4 APN 3 95677246 missense probably damaging 1.00
R0099:Adamtsl4 UTSW 3 95684139 missense probably benign 0.00
R0718:Adamtsl4 UTSW 3 95679608 missense possibly damaging 0.49
R0962:Adamtsl4 UTSW 3 95684488 nonsense probably null
R1157:Adamtsl4 UTSW 3 95683661 missense possibly damaging 0.88
R1434:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R1486:Adamtsl4 UTSW 3 95681856 missense probably benign 0.23
R1579:Adamtsl4 UTSW 3 95685497 start gained probably benign
R1703:Adamtsl4 UTSW 3 95677614 missense probably damaging 1.00
R1757:Adamtsl4 UTSW 3 95677942 missense probably benign 0.00
R2018:Adamtsl4 UTSW 3 95681102 missense probably damaging 1.00
R2108:Adamtsl4 UTSW 3 95681047 missense probably damaging 1.00
R3889:Adamtsl4 UTSW 3 95680857 missense probably damaging 1.00
R4062:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4063:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4124:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4128:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4432:Adamtsl4 UTSW 3 95681759 splice site probably null
R4433:Adamtsl4 UTSW 3 95681759 splice site probably null
R4643:Adamtsl4 UTSW 3 95684619 missense possibly damaging 0.90
R4694:Adamtsl4 UTSW 3 95679745 missense probably damaging 1.00
R4719:Adamtsl4 UTSW 3 95679586 critical splice donor site probably null
R4929:Adamtsl4 UTSW 3 95678005 missense probably damaging 1.00
R5044:Adamtsl4 UTSW 3 95681650 critical splice donor site probably null
R5212:Adamtsl4 UTSW 3 95677670 missense probably damaging 1.00
R5234:Adamtsl4 UTSW 3 95680920 missense probably benign 0.00
R5268:Adamtsl4 UTSW 3 95680163 missense probably damaging 0.98
R5473:Adamtsl4 UTSW 3 95679993 missense probably damaging 0.98
R5509:Adamtsl4 UTSW 3 95681357 missense probably benign 0.00
R5566:Adamtsl4 UTSW 3 95685455 critical splice donor site probably null
R5891:Adamtsl4 UTSW 3 95682313 missense possibly damaging 0.95
R5906:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R6224:Adamtsl4 UTSW 3 95681729 missense probably damaging 1.00
R6530:Adamtsl4 UTSW 3 95681054 missense probably benign 0.00
R6861:Adamtsl4 UTSW 3 95680884 missense probably damaging 1.00
R7199:Adamtsl4 UTSW 3 95680809 missense probably benign 0.00
R8083:Adamtsl4 UTSW 3 95684401 missense possibly damaging 0.76
R8251:Adamtsl4 UTSW 3 95684574 missense probably damaging 1.00
R8723:Adamtsl4 UTSW 3 95677116 missense possibly damaging 0.80
R8724:Adamtsl4 UTSW 3 95677116 missense possibly damaging 0.80
R8725:Adamtsl4 UTSW 3 95677116 missense possibly damaging 0.80
R8786:Adamtsl4 UTSW 3 95685474 start codon destroyed probably null 0.98
R9218:Adamtsl4 UTSW 3 95681094 nonsense probably null
R9257:Adamtsl4 UTSW 3 95681265 missense probably damaging 1.00
R9632:Adamtsl4 UTSW 3 95681780 missense probably damaging 0.96
R9749:Adamtsl4 UTSW 3 95684147 missense probably benign
X0028:Adamtsl4 UTSW 3 95676964 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTGTCCAAGGTCACATTTACAG -3'
(R):5'- AAGGGACTGTGAACTGTTGG -3'

Sequencing Primer
(F):5'- GTCACATTTACAGGTAGGGCC -3'
(R):5'- ACTGTGAACTGTTGGAAGGG -3'
Posted On 2021-04-30