Incidental Mutation 'R8701:Cyp2j12'
ID 669049
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Name cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms OTTMUSG00000007939, Cyp2j12-ps
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 95987555-96029389 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96009810 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 183 (K183M)
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000121694]
AlphaFold G3UXT0
Predicted Effect possibly damaging
Transcript: ENSMUST00000097972
AA Change: K183M

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225
AA Change: K183M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,836,785 (GRCm39) I659V probably benign Het
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or51r1 A T 7: 102,227,899 (GRCm39) M66L possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Sp6 A T 11: 96,913,090 (GRCm39) T268S probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tead4 T A 6: 128,219,529 (GRCm39) K237N probably damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 95,994,826 (GRCm39) splice site probably benign
IGL01655:Cyp2j12 APN 4 96,003,814 (GRCm39) missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 95,990,363 (GRCm39) missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96,010,895 (GRCm39) makesense probably null
IGL01936:Cyp2j12 APN 4 96,021,306 (GRCm39) missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 95,987,999 (GRCm39) missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96,021,231 (GRCm39) critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96,029,262 (GRCm39) missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 95,990,316 (GRCm39) missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96,001,099 (GRCm39) splice site probably benign
R1016:Cyp2j12 UTSW 4 96,001,102 (GRCm39) critical splice donor site probably null
R1251:Cyp2j12 UTSW 4 96,003,903 (GRCm39) nonsense probably null
R1753:Cyp2j12 UTSW 4 96,009,669 (GRCm39) splice site probably null
R2258:Cyp2j12 UTSW 4 96,021,315 (GRCm39) missense probably damaging 1.00
R4471:Cyp2j12 UTSW 4 96,021,306 (GRCm39) missense probably benign 0.01
R4559:Cyp2j12 UTSW 4 96,001,194 (GRCm39) missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96,021,230 (GRCm39) critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 95,990,346 (GRCm39) missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 95,990,388 (GRCm39) splice site probably null
R5591:Cyp2j12 UTSW 4 96,029,359 (GRCm39) start gained probably benign
R5897:Cyp2j12 UTSW 4 95,990,279 (GRCm39) missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96,029,074 (GRCm39) missense probably damaging 0.99
R6942:Cyp2j12 UTSW 4 96,001,101 (GRCm39) critical splice donor site probably null
R7422:Cyp2j12 UTSW 4 96,029,222 (GRCm39) missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 95,990,363 (GRCm39) missense possibly damaging 0.95
R7839:Cyp2j12 UTSW 4 95,987,893 (GRCm39) missense possibly damaging 0.94
R8437:Cyp2j12 UTSW 4 95,987,899 (GRCm39) missense probably damaging 1.00
R8445:Cyp2j12 UTSW 4 96,021,259 (GRCm39) missense possibly damaging 0.82
R8683:Cyp2j12 UTSW 4 96,009,805 (GRCm39) missense probably benign 0.41
R8864:Cyp2j12 UTSW 4 96,009,750 (GRCm39) missense probably damaging 1.00
R8924:Cyp2j12 UTSW 4 95,994,685 (GRCm39) missense probably damaging 1.00
R9330:Cyp2j12 UTSW 4 95,994,791 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATCCTATAGTCTTTCCAAAATAT -3'
(R):5'- GGCTGTGGCAAGAGCTTTT -3'

Sequencing Primer
(F):5'- TGCAAAAAGAGAGAACATACTTGGC -3'
(R):5'- GGGAGGGAGGGAGAAGAGAG -3'
Posted On 2021-04-30