Incidental Mutation 'R8701:Gpr153'
ID669053
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene NameG protein-coupled receptor 153
Synonyms1110065N12Rik, PGR1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8701 (G1)
Quality Score138.008
Status Not validated
Chromosome4
Chromosomal Location152274232-152285337 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 152279101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000105650] [ENSMUST00000105651]
Predicted Effect probably benign
Transcript: ENSMUST00000055754
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105650
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105651
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,445 V218D probably benign Het
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Adamtsl4 T A 3: 95,684,966 D24V possibly damaging Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cd209c C T 8: 3,945,892 R6H probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dlg5 G A 14: 24,176,700 T378M probably benign Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Il18rap A G 1: 40,539,341 E304G probably benign Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152281966 unclassified probably benign
IGL01368:Gpr153 APN 4 152282994 missense probably benign 0.40
IGL01568:Gpr153 APN 4 152282368 splice site probably null
IGL01672:Gpr153 APN 4 152279913 nonsense probably null
R0735:Gpr153 UTSW 4 152279373 nonsense probably null
R0925:Gpr153 UTSW 4 152281874 missense probably benign
R1302:Gpr153 UTSW 4 152279943 missense probably damaging 1.00
R1829:Gpr153 UTSW 4 152282392 missense possibly damaging 0.70
R2041:Gpr153 UTSW 4 152283353 missense probably benign
R4698:Gpr153 UTSW 4 152281783 missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152279883 missense probably damaging 0.99
R5623:Gpr153 UTSW 4 152281941 missense possibly damaging 0.89
R5800:Gpr153 UTSW 4 152280077 nonsense probably null
R5940:Gpr153 UTSW 4 152283375 missense probably benign 0.12
R6773:Gpr153 UTSW 4 152279300 missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152279363 missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152282401 missense probably benign 0.01
R8170:Gpr153 UTSW 4 152280177 missense probably damaging 1.00
R8699:Gpr153 UTSW 4 152279101 start gained probably benign
R8732:Gpr153 UTSW 4 152279101 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTAGGCCTTCAACCCAGTGAG -3'
(R):5'- GCGTGCAAAGCAAGAACTC -3'

Sequencing Primer
(F):5'- ACATCCTGTTGTAAGCCAGG -3'
(R):5'- GCAAGAACTCCAGCGGCTTC -3'
Posted On2021-04-30