Incidental Mutation 'R8701:Repin1'
ID 669060
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Name replication initiator 1
Synonyms Zfp464, AP4, E430037F08Rik
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48570817-48576016 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 48574279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 403 (E403*)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
AlphaFold Q5U4E2
Predicted Effect probably null
Transcript: ENSMUST00000009420
AA Change: E347*
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118229
AA Change: E400*
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: E400*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135151
AA Change: E403*
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: E403*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154010
AA Change: E347*
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163452
AA Change: E347*
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Meta Mutation Damage Score 0.9647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,836,785 (GRCm39) I659V probably benign Het
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Cyp2j12 T A 4: 96,009,810 (GRCm39) K183M possibly damaging Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or51r1 A T 7: 102,227,899 (GRCm39) M66L possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Sp6 A T 11: 96,913,090 (GRCm39) T268S probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tead4 T A 6: 128,219,529 (GRCm39) K237N probably damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48,573,839 (GRCm39) missense probably damaging 1.00
IGL01103:Repin1 APN 6 48,574,887 (GRCm39) intron probably benign
IGL02027:Repin1 APN 6 48,573,407 (GRCm39) missense probably damaging 1.00
IGL02143:Repin1 APN 6 48,574,055 (GRCm39) missense probably damaging 1.00
R0395:Repin1 UTSW 6 48,574,459 (GRCm39) missense probably damaging 1.00
R1233:Repin1 UTSW 6 48,574,768 (GRCm39) missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48,574,684 (GRCm39) missense probably damaging 0.96
R2259:Repin1 UTSW 6 48,573,464 (GRCm39) missense probably benign 0.00
R4509:Repin1 UTSW 6 48,573,460 (GRCm39) missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48,573,542 (GRCm39) missense probably damaging 1.00
R5009:Repin1 UTSW 6 48,571,779 (GRCm39) intron probably benign
R5425:Repin1 UTSW 6 48,573,365 (GRCm39) missense probably benign 0.18
R5829:Repin1 UTSW 6 48,571,766 (GRCm39) intron probably benign
R6350:Repin1 UTSW 6 48,574,562 (GRCm39) missense probably damaging 0.98
R6841:Repin1 UTSW 6 48,574,859 (GRCm39) missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48,570,825 (GRCm39) intron probably benign
R7067:Repin1 UTSW 6 48,574,850 (GRCm39) nonsense probably null
R7636:Repin1 UTSW 6 48,573,299 (GRCm39) missense probably benign 0.00
R7699:Repin1 UTSW 6 48,574,756 (GRCm39) missense probably damaging 0.96
R7700:Repin1 UTSW 6 48,574,756 (GRCm39) missense probably damaging 0.96
R7747:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7748:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7781:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7815:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7820:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7869:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7988:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7991:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8078:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8079:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8080:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8088:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8089:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8130:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8131:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8324:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8325:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8342:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8411:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8488:Repin1 UTSW 6 48,570,952 (GRCm39) missense probably damaging 0.98
R8542:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8543:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8544:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8697:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8699:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8702:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8731:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8732:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8780:Repin1 UTSW 6 48,574,073 (GRCm39) missense probably damaging 0.99
R8879:Repin1 UTSW 6 48,574,367 (GRCm39) missense possibly damaging 0.73
R9049:Repin1 UTSW 6 48,574,646 (GRCm39) missense possibly damaging 0.86
R9465:Repin1 UTSW 6 48,571,877 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCATACATACCGGCGAGAAG -3'
(R):5'- CACATAGGGTTTCTCGCCTG -3'

Sequencing Primer
(F):5'- TACCCATGCACCGAGTGTGG -3'
(R):5'- TGGCTGCCCTGTGAGAAAC -3'
Posted On 2021-04-30