Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Ptcd3'

669062

Institutional Source

Beutler Lab

Gene Symbol

Ptcd3

Ensembl Gene

ENSMUSG00000063884

Gene Name

pentatricopeptide repeat domain 3

Synonyms

2610034F17Rik, 2810422B04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71880638-71908750 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71885511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 480 (D480G)

Ref Sequence

ENSEMBL: ENSMUSP00000080743 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879]

AlphaFold

Q14C51

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082094
AA Change: D480G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: D480G

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	216	227	N/A	INTRINSIC
Pfam:PPR_2	253	300	1.4e-10	PFAM
Pfam:PPR_3	331	366	2.1e-4	PFAM
low complexity region	671	684	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205556

Predicted Effect

probably benign
Transcript: ENSMUST00000206879

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,445	V218D	probably benign	Het
Abcc4	T	C	14: 118,599,373	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,684,966	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,316,092	F117I	probably damaging	Het
Aldh3b2	A	G	19: 3,978,448	E116G	probably damaging	Het
Alox5	T	A	6: 116,413,826	I455F	possibly damaging	Het
Arnt	C	T	3: 95,493,765	S675F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,007,141	Y456*	probably null	Het
Camkv	A	G	9: 107,948,041	T414A	possibly damaging	Het
Cd209c	C	T	8: 3,945,892	R6H	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,121,573	K183M	possibly damaging	Het
Dact3	G	T	7: 16,885,276	R232L	probably damaging	Het
Dlg5	G	A	14: 24,176,700	T378M	probably benign	Het
Dnah10	T	A	5: 124,726,847	D79E	probably benign	Het
Dsc1	A	T	18: 20,107,682	Y195*	probably null	Het
Elovl1	A	T	4: 118,430,510	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283	M155T	probably damaging	Het
Gm28308	C	G	6: 52,163,450		probably benign	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gtf2ird2	T	A	5: 134,216,235	I445N	probably damaging	Het
Gzmb	A	T	14: 56,260,360	V141E	probably benign	Het
Hmcn1	A	T	1: 150,755,257	M930K	probably benign	Het
Hunk	T	A	16: 90,386,610	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,539,341	E304G	probably benign	Het
Klk14	A	G	7: 43,694,142	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,095,153	S695P	probably damaging	Het
Mccc1	A	T	3: 35,995,784	D86E	probably benign	Het
Mcu	T	A	10: 59,467,653	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,107,191	F90S	possibly damaging	Het
Muc2	A	G	7: 141,695,607	D536G	probably damaging	Het
Naa11	T	C	5: 97,391,958	S114G	possibly damaging	Het
Ncaph	T	C	2: 127,106,138	K676E	probably benign	Het
Neurl2	C	T	2: 164,833,134	D103N	probably benign	Het
Nup210l	T	C	3: 90,122,814	M278T	probably benign	Het
Olfr1192-ps1	A	G	2: 88,652,487	I112V	possibly damaging	Het
Olfr550	A	T	7: 102,578,692	M66L	possibly damaging	Het
Olfr897-ps1	A	T	9: 38,309,438	L214F	unknown	Het
Olfr967	A	T	9: 39,750,914	H176L	probably damaging	Het
Olfr981	A	G	9: 40,022,519	N42S	probably damaging	Het
Pcdh20	A	T	14: 88,468,413	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,574,683	Y3598C	probably damaging	Het
Plcg2	T	A	8: 117,581,677	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,830,642	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615	C625Y	probably damaging	Het
Rbm39	T	A	2: 156,161,587	K291M	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf220	T	C	4: 117,489,993	H74R	probably damaging	Het
Sp6	A	T	11: 97,022,264	T268S	probably damaging	Het
Sphk2	A	T	7: 45,710,825	V585E	probably damaging	Het
Syne1	G	A	10: 5,205,026	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,861,046	V573I	probably benign	Het
Tdrd1	T	C	19: 56,851,484	S659P	possibly damaging	Het
Tead4	T	A	6: 128,242,566	K237N	probably damaging	Het
Tex24	T	A	8: 27,345,124	C227S	probably benign	Het
Tom1	A	T	8: 75,052,168	T174S	probably benign	Het
Tpm3	C	T	3: 90,087,680	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,278,936	E111G	possibly damaging	Het
Unc80	A	G	1: 66,638,032	D2040G	possibly damaging	Het
Usp47	A	G	7: 112,093,195	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,047,690	A590V	probably damaging	Het
Wisp2	G	T	2: 163,828,866	G98W	probably damaging	Het
Zfp112	A	G	7: 24,125,740	R382G	probably damaging	Het
Zfp606	T	A	7: 12,481,098	D84E	unknown	Het

Other mutations in Ptcd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00767:Ptcd3	APN	6	71903448	missense	probably damaging	0.96
IGL00903:Ptcd3	APN	6	71907844	missense	possibly damaging	0.93
IGL01545:Ptcd3	APN	6	71888577	missense	probably benign	0.01
IGL01924:Ptcd3	APN	6	71898427	missense	probably damaging	1.00
IGL02675:Ptcd3	APN	6	71883442	critical splice donor site	probably null
R0732:Ptcd3	UTSW	6	71881171	unclassified	probably benign
R1374:Ptcd3	UTSW	6	71908653	nonsense	probably null
R1393:Ptcd3	UTSW	6	71889621	missense	probably benign	0.00
R1498:Ptcd3	UTSW	6	71893495	missense	probably damaging	1.00
R1646:Ptcd3	UTSW	6	71898395	missense	probably benign	0.26
R1712:Ptcd3	UTSW	6	71908653	nonsense	probably null
R2022:Ptcd3	UTSW	6	71885553	missense	probably damaging	1.00
R2248:Ptcd3	UTSW	6	71894285	critical splice donor site	probably null
R2406:Ptcd3	UTSW	6	71888647	missense	probably damaging	1.00
R3418:Ptcd3	UTSW	6	71883486	missense	possibly damaging	0.93
R3419:Ptcd3	UTSW	6	71883486	missense	possibly damaging	0.93
R4677:Ptcd3	UTSW	6	71893514	missense	probably benign	0.17
R4741:Ptcd3	UTSW	6	71902949	missense	probably damaging	1.00
R4752:Ptcd3	UTSW	6	71901312	missense	probably damaging	0.99
R5441:Ptcd3	UTSW	6	71881521	missense	possibly damaging	0.62
R5583:Ptcd3	UTSW	6	71902936	missense	probably damaging	1.00
R5681:Ptcd3	UTSW	6	71907659	missense	probably damaging	1.00
R6028:Ptcd3	UTSW	6	71898408	missense	probably damaging	1.00
R6324:Ptcd3	UTSW	6	71885327	missense	probably benign	0.00
R6537:Ptcd3	UTSW	6	71897110	splice site	probably null
R6600:Ptcd3	UTSW	6	71883546	missense	probably damaging	1.00
R6783:Ptcd3	UTSW	6	71908643	missense	probably benign	0.00
R6810:Ptcd3	UTSW	6	71885532	missense	probably damaging	0.99
R6860:Ptcd3	UTSW	6	71897110	splice site	probably null
R6993:Ptcd3	UTSW	6	71885315	missense	probably damaging	1.00
R7578:Ptcd3	UTSW	6	71908707	missense	probably benign
R7788:Ptcd3	UTSW	6	71885557	missense	probably benign	0.00
R7851:Ptcd3	UTSW	6	71902859	missense	probably damaging	1.00
R7888:Ptcd3	UTSW	6	71883447	missense	probably damaging	1.00
R7889:Ptcd3	UTSW	6	71888608	missense	probably damaging	1.00
R7919:Ptcd3	UTSW	6	71903454	missense	probably damaging	1.00
R8162:Ptcd3	UTSW	6	71907814	missense	probably benign	0.02
R8351:Ptcd3	UTSW	6	71908641	missense	probably benign	0.00
R8451:Ptcd3	UTSW	6	71908641	missense	probably benign	0.00
R8826:Ptcd3	UTSW	6	71908661	missense	probably benign	0.01
R8926:Ptcd3	UTSW	6	71892480	missense	probably damaging	1.00
R8969:Ptcd3	UTSW	6	71903447	missense	probably benign	0.44
R9031:Ptcd3	UTSW	6	71903474	nonsense	probably null
R9046:Ptcd3	UTSW	6	71893380	critical splice donor site	probably null
R9384:Ptcd3	UTSW	6	71897126	missense	possibly damaging	0.77
R9668:Ptcd3	UTSW	6	71894291	missense	possibly damaging	0.93
R9771:Ptcd3	UTSW	6	71895919	nonsense	probably null
X0024:Ptcd3	UTSW	6	71901274	missense	probably damaging	1.00
X0065:Ptcd3	UTSW	6	71907806	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCACATCCAATGCTTGAAG -3'
(R):5'- GACAACTTTGTGGAGTGAGTCC -3'

Sequencing Primer
(F):5'- CCAATGCTTGAAGAAGACCTATG -3'
(R):5'- TACCCATCTCACTGACCTAAAGTTG -3'

Posted On

2021-04-30