Incidental Mutation 'R8701:Tead4'
ID 669064
Institutional Source Beutler Lab
Gene Symbol Tead4
Ensembl Gene ENSMUSG00000030353
Gene Name TEA domain family member 4
Synonyms TEAD-4, Etfr2, Tef3, Tcf13r1, Tefr, ETFR-2a, TEF-3, Tefr1a, Rtef1
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 128204106-128277776 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128219529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 237 (K237N)
Ref Sequence ENSEMBL: ENSMUSP00000006311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006311] [ENSMUST00000112157] [ENSMUST00000130454]
AlphaFold Q62296
Predicted Effect probably damaging
Transcript: ENSMUST00000006311
AA Change: K237N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006311
Gene: ENSMUSG00000030353
AA Change: K237N

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
low complexity region 121 130 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
PDB:4LN0|B 209 427 1e-164 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000112157
AA Change: K194N

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107784
Gene: ENSMUSG00000030353
AA Change: K194N

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
Pfam:TEA 111 376 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130454
AA Change: K194N

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118083
Gene: ENSMUSG00000030353
AA Change: K194N

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
Pfam:TEA 111 376 2.2e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. This factor may play a role in the embryonic development of skeletal muscle. Alternatively spliced transcripts encoding distinct isoforms, which are translated through the use of a non-AUG (AUU) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die prior to somitogenesis, lack trophoblast stem cells and develop abnormally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,836,785 (GRCm39) I659V probably benign Het
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Cyp2j12 T A 4: 96,009,810 (GRCm39) K183M possibly damaging Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or51r1 A T 7: 102,227,899 (GRCm39) M66L possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Sp6 A T 11: 96,913,090 (GRCm39) T268S probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Tead4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0234:Tead4 UTSW 6 128,220,365 (GRCm39) missense probably damaging 1.00
R0234:Tead4 UTSW 6 128,220,365 (GRCm39) missense probably damaging 1.00
R2054:Tead4 UTSW 6 128,247,925 (GRCm39) missense probably damaging 1.00
R2865:Tead4 UTSW 6 128,225,062 (GRCm39) splice site probably null
R4959:Tead4 UTSW 6 128,247,950 (GRCm39) missense probably damaging 1.00
R4973:Tead4 UTSW 6 128,247,950 (GRCm39) missense probably damaging 1.00
R5023:Tead4 UTSW 6 128,271,134 (GRCm39) intron probably benign
R5051:Tead4 UTSW 6 128,271,262 (GRCm39) intron probably benign
R6785:Tead4 UTSW 6 128,219,444 (GRCm39) nonsense probably null
R7215:Tead4 UTSW 6 128,205,641 (GRCm39) missense probably damaging 1.00
R7913:Tead4 UTSW 6 128,220,331 (GRCm39) critical splice donor site probably null
R9283:Tead4 UTSW 6 128,205,592 (GRCm39) missense probably damaging 1.00
Z1088:Tead4 UTSW 6 128,247,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTACCCAGAACTTCACAAG -3'
(R):5'- AGCTAGGGTGACTCTAGTGG -3'

Sequencing Primer
(F):5'- TTCACAAGGAAGAAGGCATTAGAG -3'
(R):5'- GGGGAATCCATCTCATCTGAG -3'
Posted On 2021-04-30